Labshake search
Citations for New England Biolabs :
751 - 800 of 888 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and phosphorylated according to the following protocol: 20 nmol of the pooled probes were phosphorylated in 1X PNK buffer (B0201S, New England Biolabs), 1 mM ATP (P0756S ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
Asymptomatic neonatal herpes simplex virus infection in mice leads to long-term cognitive impairmentbioRxiv - Microbiology 2024Quote: ... qPCR reactions were performed using the following components to a final reaction volume of 20 μl: 1X Luna Universal qPCR Master Mix (New England Biolabs), forward and reverse primers at a final concentration of 0.25 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Developmental Biology 2024Quote: ... a total of 1μg of the sgRNA pair along with 20 pmol recombinant Cas9 (EnGen S. pyogenes Cas9 NLS from NEB, M0646T) were injected into the C ...
-
bioRxiv - Biophysics 2024Quote: ... In vitro pull-down binding assays were performed in triplicate by incubating proteins at their indicated concentrations with 20 µL amylose resin (bead bed volume; New England Biolabs) in a 200 µL reaction in Assay Buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... adapter duplex to DNA fragments was performed overnight at 16°C in a final volume of 20 µL with 2.5 µM dsAdR and 400 units of T4 DNA ligase (NEB M0202S). Reaction was cleaned up using nucleospin PCR clean-up XS column (Macherey Nagel ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 200 ng of purified product was used in a 20 µL IVT reaction using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), fully substituting UTP with N1-methylpseudouridine-5’-phosphate (TriLink Biotechnologies ...
-
bioRxiv - Zoology 2024Quote: ... the worms were rehydrated with increasing concentration of PBS+0.1%Tween-20 and then subjected to the proteinase K (NEB, P8107S) treatment used at 10 μg/ml concentration for 2 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... Linearization was performed by overnight digest at 37C° of 10 µg of donor plasmid using 20 Units of PaqCI (R0745, NEB) in 1x rCutSmart buffer (B6004S ...
-
bioRxiv - Molecular Biology 2024Quote: ... Precipitated cDNAs were stored at -20°C before performing PCR using P5/P7 standard Illumina primers and Phusion HF master mix (NE-M0531L, NEB). Ribosomal RNA contaminants were removed from the final library using Ribocutter which utilises Cas9-guided rRNA depletion (Wilkins and Ule ...
-
bioRxiv - Microbiology 2024Quote: ... And a positive control reaction was performed where lysate was substituted with 2 µL (20 U) of purified Exonuclease I (NEB). Reactions were allowed to incubate for 1 min at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were then washed three times with buffer B (1.2 M sorbitol and 100 mM potassium phosphate buffer pH 7.5) and resuspended in 500 μL of spheroplast buffer (buffer B containing 20 mM VRC (Ribonucleoside–vanadyl complex NEB #S1402S), and 25 U of Lyticase enzyme (Sigma #L2524 ...
-
bioRxiv - Biochemistry 2024Quote: ... gRNA targeting a 20 nt genomic region adjacent to a Cas9 protospacer adjacent motif (PAM) was first annealed and cloned into BsmbI (NEB) digested pLentiCRISPRv2 vector ...
-
bioRxiv - Plant Biology 2024Quote: ... Primers for PCR fragments bearing 20 bp overlapping to the flanking region were produced with Phusion High-Fidelity DNA Polymerase (NEB) and 40-mer primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2024Quote: Lysates were treated with 20 μg·ml-1 of RNase A and 2U·ml-1 of DNase I (New England Biolabs, Whitby, Canada) along with 10% DNase buffer 10x at 37°C for 30 min followed by heat inactivation at 75°C for 10 min ...
-
bioRxiv - Systems Biology 2024Quote: ... Annealed oligos are diluted 1:20 with DNase free water and 1uL is used in a Hi-T4 (NEB, M2622S) ligation reaction at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Neuroscience 2024Quote: ... we prepared DNA standards by linearizing 20 µg of the respective transfer plasmid with the restriction enzyme ScaI (catalog number R3122S, New England Biolabs), then ran the product on a 0.9% agarose gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... or PCR-amplification of the target DNA sequence using primers that contain a ∼20-bp overlap with the entry module using Q5 polymerase (NEB) or GXL (Takara Bio) ...
-
bioRxiv - Genomics 2024Quote: ... 20-50mg of frozen brain tissue was sliced off into a tube and covered with DNA/RNA Protection Reagent (NEB). Zirconium beads (3.0mm ...
-
bioRxiv - Genomics 2024Quote: ... PCR that was performed in 60 µl reactions as follows: 20 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Biochemistry 2024Quote: ... at 37 °C for 20 minutes before being purified using a Monarch RNA purification kit using 2X volume ethanol (New England Biolabs). Concentration determined using a Nanodrop ND-1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... Purified templates were used in 20 μL T7 in vitro transcription reactions using the HiScribe T7 in vitro transcription kit (New England Biolabs) at 100 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... The first step of the reaction amplified the barcode region using custom primers for 20 cycles with NEB Q5 Hot Start DNA Polymerase (New England Biolabs). Primer sequences are listed in Supp ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL of linearised backbone and 1 µL digested pMB.BIG1a-e mix were used to set up a 20 µL Gibson Assembly (NEB #E2611) reaction ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was then diluted 1:4 to a total volume of 20 μL and 1 μL was used as template for qPCR with the Luna qPCR Master Mix (New England Biolabs) in a total reaction volume of 10 μL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50 ng of DNA from selected fractions was heat-denatured to single-stranded DNA (ssDNA) and then digested into nucleosides with 20 units of Nuclease P1 (#M0660, NEB) for 2 h followed by 1 h incubation with 10 units of CIP Alkaline phosphatase (#M0290 ...
-
bioRxiv - Biochemistry 2024Quote: ... 2:1 molar ratio of trimerization domain:plasmid were ligated at 37°C for 20 minutes in a 10 µl mixture reaction containing: 1 μL T4 ligase buffer (NEB), 0.5 μL PaqCI (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... oocytes were dissolved in 20 µl of 1x NEB buffer containing 800 U of LPP enzyme (P0753, New England BioLabs) and incubated at 30°C for 1 h.
-
bioRxiv - Genetics 2020Quote: ... During the experiment a fresh aliquot with 46 ng/μl sgRNA and 3.13 μM commercial Cas9 enzyme (Cas9 Nuclease, S. pyogenes, 20 μM; NEB, Ipswich, USA) was used for each day and stored on ice.
-
bioRxiv - Genomics 2020Quote: ... and 0.4 μl of 20 mg/ml BSA with 1 μl (10 U/μl) of T4 endonuclease V (NEB, T4-PDG) and 1 μl (10 U/μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase-free DNase Buffer was added to the samples until 1X final concentration together with 20 units of DNase I (NEB, M0303L) and incubated at 37°C for 20 minutes ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... μl of eluted DNA from the previous digestion in 1x final concentration CutSmart buffer with 20 U SphI-HF (NEB R3182S). Digestion was carried out for 1 hour at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL P7 primer (10 μM) (5ʹ-CAAGCAGAAGACGGCATACGAG AT[i7] GTCTCGTGGGCTCGG-3ʹ; IDT) and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541). Amplification was performed using the following program ...
-
bioRxiv - Systems Biology 2021Quote: ... The final enrichment PCR used primers MO588 and MO589 (Supplementary file 6) for 20 cycles at an annealing temperature of 66C (NEB Phusion), followed by purification with the Monarch PCR kit ...
-
bioRxiv - Systems Biology 2020Quote: ... the samples were then incubated with 20-fold diluted Quick Ligase in 1× Quick Ligase Reaction Buffer from Quick Ligation Kit (NEB M2200) supplemented with additional 1 mM ATP (NEB P0756 ...
-
bioRxiv - Systems Biology 2021Quote: ... The samples were then incubated with 20-fold diluted Quick Ligase in 1× Quick Ligase Reaction Buffer from Quick Ligation Kit (NEB M2200) supplemented with an additional 1 mM ATP (NEB P0756 ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng total RNA per 20 µl reaction were analyzed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006) in technical triplicates ...
-
bioRxiv - Genomics 2022Quote: ... The Hi-TrAC libraries were then amplified with multiplexing indexed primers in the following reaction mixture: 20 μL Phusion HF PCR Master Mix (NEB, M0531S), 1 μL Illumina Multiplexing PCR primer 1.0 (10 μM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed as described above and either directly resuspended in Proteinase K reaction or in 20 μl of RecJ adapter removal reaction (1X NEB Buffer 2 (NEB, #B7002S), 25U 5’ Deadenylase (NEB ...
-
bioRxiv - Microbiology 2021Quote: The fusion protein was purified from the clarified supernatants by adding 20 ml of chitin resin (New England Biolabs, cat#S6651S) and incubating with gentle rotation overnight at 4°C ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... Fifteen million cells were fixed and DNA was digested upon 20 min incubation with 312 U MNase (New England BioLabs, M0247S) per 106 cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... TE buffer (20 µL) was added and PCR was performed using NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs, M0541) as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... chromatin and chromatin bound fractions were released from magnetic beads using binding buffer containing 5 mM CaCl2 plus an excess (2000 units/ 20 mL reaction) of micrococcal nuclease (MNase; NEB, M0247S) Beads were incubated for 5 minutes at 37 °C with shaking (1250 rpm) ...
-
bioRxiv - Developmental Biology 2021Quote: ... After annealing the complex an equimolar amount was mixed with 1000 ng Cas9 recombinant protein (NEB; final concentration 20 ng/μL) and incubated at RT for 15 min ...
-
bioRxiv - Synthetic Biology 2021Quote: Expression units were assembled from cloned level 0 parts into level 1 destination vectors provided by the MoClo kit using 40fmol of each vector and 20 U of BsaI-HFv2 (NEB, R3733L) with remaining conditions as described above ...
-
bioRxiv - Genomics 2021Quote: ... and supernatant was transferred to a new tube and added to 2 μL 10% SDS and 2 μL 20 mg/mL proteinase K (New England Biolabs P8107). Samples were incubated overnight at 65°C to reverse crosslinks ...
-
bioRxiv - Genomics 2022Quote: ... Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 μL) Taq ligase (NEB M0208L) and incubation at 55°C for 1 hour then 75°C for 10 min ...