Labshake search
Citations for New England Biolabs :
601 - 650 of 888 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Immunology 2022Quote: ... Then 1 μg of vaccine mRNA was ligated to 20 pmols RA3_7N adaptor: 5rApp/CTGACNNNNNNNTGGAATTCTCGGGTGCCAAGG/3ddC with 10U of T4 KQ227 RNA ligase 1 (#M0204S NEB) in the presence of 20U RNase OUT (#10777019 ...
-
bioRxiv - Immunology 2023Quote: pals-17::gfp and pals-20::wrmScarlet translational reporter constructs were assembled using NEBuilder HiFi kit (New England Biolabs) by fusing PCR products and gene fragments ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of the reaction product was treated with 1 μL of CIP or nuclease P1 (New England BioLabs) at 37 °C for 1 h and inactivated at 80 °C for 10 min prior to centrifugation and analysis by HPLC.
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 mM EDTA) and digested with DraIII-HF in 1x CutSmart buffer for ∼20 hr at 37 °C (NEB). Fragments with DraIII sticky ends were re-purified by 1 mL mono-Q ion-exchange ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by 20 pmol membrane permeable SNAP dye (10 μM SNAP-Cell® 647-SiR, New England BioLabs Inc.) in reconstitution buffer supplemented with 1 mM DTT or with each dye separately ...
-
bioRxiv - Genetics 2023Quote: To each tube/sample was added 20 μL of 10X MNase buffer (New England Biolabs Inc.; Ipswich MA, USA), 0.5 μL of 1M MgCl2 ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Neuroscience 2023Quote: ... sense and antisense oligos containing the 20 bp guide target sequence wereannealed and phosphorylated with T4 Polynucleotide Kinase (NEB), then inserted between BbsI sites in the plasmid ...
-
bioRxiv - Genomics 2023Quote: ... were obtained by subjecting genomic DNA purified from yeast cells as above to three rounds of M.EcoGII treatment to maximise methylation (10-20 μg DNA in 160 μl NEB buffer 2.1 with 0.8 mM SAM ...
-
bioRxiv - Molecular Biology 2023Quote: 20 µM of TOPOVIBLΔC25 monomers purified in the presence of IAA was incubated with 50 µM ATP (P0756L, NEB) or AMP-PNP (64473120 ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 1.5 Kbp windows and then searched 20 bp sequences up- and downstream of each SNP for RE recognition sites using NEBcutter V2.0 (New England BioLabs; http://nc2.neb.com/NEBcutter2/index.php) ...
-
bioRxiv - Bioengineering 2023Quote: ... 20 ng of each integrase amplicon was used per reaction using PURExpress® In Vitro Protein Synthesis Kit (NEB) in a total volume of 9 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the DpnI adaptor was ligated in 20 µl volume with 2.5 units of T4 DNA ligase (NEB; M0202). This was followed by DpnII digestion in a total volume of 50 µl with 10U of DpnII (NEB ...
-
bioRxiv - Microbiology 2023Quote: 20 ng of nucleic acid was enriched for viral genomic sequences using NEBNext Microbiome DNA Enrichment Kit (NEB, E2612) to reduce host genomic DNA contamination ...
-
bioRxiv - Systems Biology 2023Quote: ... originating from plasmid pGD009 20 was ligated into the backbone using NEB T4 Ligase (New England Biolabs, Ipswitch, MA) according to the manufacturers protocol using 29 fmol of backbone and 87 fmol of insert ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
bioRxiv - Immunology 2024Quote: ... Glycan removal was performed on 20 µg or 25 µg total protein using PNGase F (#P0704; New England Biolabs), Endo H (#P0702 ...
-
bioRxiv - Biochemistry 2024Quote: ... This modified coding region was inserted into pRP4-TX(WT)20 via digestion with AflII and SpeI (both NEB) and ligation with T4 DNA Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 µg/mL recombinant albumen at pH 7.9; New England Biolabs) and 0.75 µL DpnI (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation reactions were carried out overnight at 16°C using 1µl of T4 DNA Ligase (20 U/µl; NEB). Plasmids were then cloned in E ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of small RNA was reacted in a final volume of 20 µL with 1x Heparinase Buffer (NEB) and 0.5 µL of each of the three heparinase enzymes described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA from each phosphatase or control reaction was then used to set up two reactions 20 μL reactions containing 1 μg of treated RNA in NEBuffer 3.1 (New England Biolabs) with or without the addition of 1 μL (1U ...
-
bioRxiv - Neuroscience 2024Quote: ... the gel was immersed in 0.3 M sodium acetate solution containing 20 Unit RNase inhibitor (New England Biolabs, M0314L) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μl each of two complementary oligonucleotides (Mut_sgRNA_F and Mut_sgRNA_R) (Supplementary file 1) at a concentration of 20 μM and 2 μl of NEBuffer 2 (NEB B7002S) were added into an Eppendorf tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... TeeVax3 antigen was buffer exchanged into 20 mM Tris pH 7.5 and digested overnight at 4 °C with TEV Protease (NEB). Undigested antigen and digested His tags were captured by Ni-NTA chromatography as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a mix of three restriction enzymes: 30 µl of NcoI-HF (20 U/µl, NEB, cat. no. R3193S), 30 µl of BclI-HF (20 U/µl ...
-
bioRxiv - Plant Biology 2020Quote: ... captured messenger RNA was isolated from the lysate by adding 20 µL of LBB-washed streptavidin-coated magnetic beads (New England Biolabs) and was allowed to stand for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... to 3 μM concentration in a total volume of 50 μl and mixed with 20 μl amylose beads (New England BioLabs). After mixing the proteins and the beads ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantification of mRNA level was performed in a 20 μl mixture consisting of 10 μl Q5 High-Fidelity 2X Master Mix (NEB), 0.2 μl RT-PCR product ...
-
bioRxiv - Cell Biology 2020Quote: ... at 68°C for 20 min and transferred to 42°C where 1.5 μL of ß-agarase (New England Biolabs) was added and incubated overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Following the adaptor ligation each sample was mixed with 20 μl of a 2x DpnII Digestion Buffer and 10 units (1 μl) of DpnII restriction enzyme (New England Biolabs) mastermix and were incubated for 3 hours at 37 °C ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: ... DNA was repaired by adding a cocktail of 20 μL of the end-repair mix [3.5X NEB ligation buffer (NEB, B0202S), 17.5 mM dNTP mix ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were individually treated for 16 h at 37 °C with 20 units of DpnI enzyme (New England Biolabs). Following gel extraction using Wizard SV Gel and PCR CleanUp System (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Experiments comparing the impact of DNase I and RNase A on the migration of AbmR by SEC were completed by adding approximately 200 ug of purified AbmR 39S complexes to 20 units of DNase I (New England Biolabs) or 50 ug/ml of protease-free RNase A (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: The L3 DNA linker at 0.5 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using 5 U/μl of RNA Ligase Truncated K227Q (NEB) in the presence of 15% PEG8000 and 1 U/μl RNasin (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... A custom-made SYBR-based master mix was used for qPCR: 20 µL reactions were made with ThermoPol buffer (New England Biolabs), and contained 2.5 mM MgSO4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... left to air-dry and then digested overnight at 37°C in 50 μl TE with 20 U EcoRI-HF (NEB). Samples were extracted with 50 μl phenol:chloroform ...
-
Reprogramming enriches for somatic cell clones with small scale mutations in cancer-associated genesbioRxiv - Genomics 2020Quote: ... PCR products of 1400-1600bp were generated by running 20 PCR cycles with a Q5 Hot Start High Fidelity DNA Polymerase (NEB GmbH ...
-
bioRxiv - Genetics 2021Quote: ... Ligation was performed in a total volume of 20 μl by the addition of 1 μl T4 DNA Ligase (400 Units, NEB) in 1X T4 DNA Ligase buffer (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg of genomic DNA was fragmented in a 20-μl reaction consisting of 2 μl of 10X fragmentase buffer (New England Biolabs) and 2 μl fragmentase (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: For the insertion of an ATTO647N-labeled oligonucleotide complementary to the position 14711 bp from the biotinylated end of the λ DNA we employed the previously described strategy14 and followed the more recently described procedure.15 2 μg of λ DNA was incubated for 2 hours with the nicking enzyme Nt.BstNBI (20 units, NEB) at 50 °C in the nickase buffer ...
-
bioRxiv - Biochemistry 2021Quote: 20 μg of SARS-CoV-2 Spike trimer was deglycosylated by incubating with 2.5 μL of PNGase F (NEB, SG) under native condition at 37 °C for 4 h ...