Labshake search
Citations for New England Biolabs :
451 - 500 of 888 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... Antibodies were then co-incubated with a 20-fold molar excess of BG-GLA-NHS (NEB) for 30 minutes at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... plasmid backbone DNA (1 μg) was digested using EcoRI-HF (20 units; R3101S, New England Biolabs) and SpeI-HF (20 units ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (NEB or Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads were first treated with T4 PNK (NEB, M0201L; 20 U in 80 μl reaction volume) in the absence of ATP (37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the reaction product was combined with 20 μl digestion mix containing 5 μl ExoI (NEB, M0293S), 5 μl HinFI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 20 µL NEBNext Quick Ligation Reaction Buffer (5X) and 10 µL Quick T4 DNA Ligase (NEB) were added (final volume 100 µL) ...
-
bioRxiv - Genetics 2020Quote: ... Each 20 μl barcoding reaction contained 10 μl Q5 High-Fidelity Master Mix (New England Biolabs), 0.8 μl forward (universal ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification was performed in 20 μl reactions using the Luna Universal qPCR Master Mix (NEB M3003L) with 1x PCR master mix ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 20 μl was used for PCR amplification using Q5 hot start high-fidelity polymerase (NEB #M0494S) and a unique combination of the dual-barcoded primers P5 and P7 Nextera XT Index kit (Illumina #15055293) ...
-
bioRxiv - Immunology 2024Quote: ... or AluI in a 20 µl reaction using Cutsmart reaction buffer (New England Biolabs, Ipswich, MA). The digested DNA was self-ligated using T4 DNA ligase (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: Endpoint PCR was performed in a 20 µL reaction volume containing 1× OneTaq Master Mix (NEB), 0.2 µM of each primer and 1 µL of 100-fold diluted cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA (5 µg in 20 µL ddH2O) was incubated with 2µL 100U Nuclease P1 (NEB) and 2 µL 10x Nuclease P1 buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The fragmented RNA was then circularized with RNA ligase 1 in 20 µl reactions (NEB, M0204S) for 2 hours at 25°C after which the circularized RNA was purified with the Oligo Clean & Concentrator kit (D4061 ...
-
bioRxiv - Biochemistry 2023Quote: ... Each PCR consisted of: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 μL 10 μM forward primer ...
-
bioRxiv - Biochemistry 2023Quote: ... the following was mixed: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 2 μL 10 μM i5 indexing adapter ...
-
bioRxiv - Cancer Biology 2023Quote: ... TCRs were then amplified by PCR (20 cycles with the Phusion from New England Biolabs, NEB) with a single primer pair binding to the constant region and the adapter linked to the TRAV/TRBV primers added during the reverse transcription ...
-
bioRxiv - Cancer Biology 2023Quote: ... TCRs were then amplified by PCR (20 cycles with the Phusion from New England Biolabs, NEB) with a single primer pair binding to the constant region and the adapter linked to the TRAV/TRBV primers added during the reverse transcription ...
-
bioRxiv - Systems Biology 2023Quote: ... 400 µL of RNAlater and 2 µL of 20 mg/mL BSA (New England Biolabs # B9000S) were added to the samples and incubated on ice for 5 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was 5’-labelled with 20 U of T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB # M0236S) and 50 pmol of (gamma-32P)ATP (Perkin Elmer ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA (30 μl) was poly(A) tailed using 20 units terminal transferase (TdT, NEB, #M0315) and 0.2 mM dATP for 15 min at 37°C in TdT buffer (20 mM Tris-HCl pH 7.9 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (ThermoFisher/NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... 1 μg PM187B20 in a 20 μL reaction volume of 1x T4 PNK buffer (NEB, M0201S) for 60 minutes at 37 °C before heat inactivation at 65°C for 25 minutes ...
-
bioRxiv - Genomics 2024Quote: ... Injection mixes were prepared with 1.3 µl of SpCas9 (20 µM, New England BioLabs, Ipswich, MA), 1.6 µl of annealed crRNA:tracrRNA ...
-
bioRxiv - Genomics 2024Quote: ... 20 μg of sheared DNA was digested with 200 U Exonuclease V (New England Biolabs, USA) at 37 ⁰C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteinase-K (PK) reaction mixes were prepared by diluting Proteinase K (20 mg/ml stock, NEB) to a final concentration of 2 mg/ml in the PK buffer and incubated at 37°C for 20 minutes to deactivate any RNAse activity ...
-
bioRxiv - Microbiology 2020Quote: ... Template DNA was then digested by addition of 20 units (1 μl) DpnI restriction enzyme (NEB: R0176S) and incubation at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... yeast tRNA and poly dIdC was substituted for 20 units of murine RNase inhibitor (New England Biolabs), 12.5 mM DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μg of protein lysates of each condition was treated with either Endo H (New England Biolabs) or PNGase F for 1 h at 37º C ...
-
bioRxiv - Plant Biology 2021Quote: ... protein pellets were dissolved in 20 μl of PNGase F denaturation buffer (New England Biolabs, Ipswich, MA) and denatured at 95°C for 10 min ...
-
bioRxiv - Genetics 2020Quote: ... We mixed 20 µg of insert or 15 µg plasmid library with 5 µL AscI (NEB R0558L), 5 µL SbfI-HF (NEB R3642L) ...
-
bioRxiv - Biochemistry 2021Quote: 20 µg protein lysate was incubated with lambda phosphatase according to the manufacturer’s protocol (New England Biolabs). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 ng of mRFP PCR products were incubated with Gibson master mix (New England Biolabs, #E2611S) at 50°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse transcription reaction (20 μL) contained 2 μL 10x M-MulV buffer (B0253S, New England Biolabs), 1 μL of 50 μM Oligo 18 dT (SO132 ...
-
bioRxiv - Developmental Biology 2022Quote: ... They were then incubated for 20 min at 25°C with the SNAP-Cell TMR-Star (NEB) at a concentration of 2 μM in Shields and Sang M3 Insect cell complete medium ...
-
bioRxiv - Cell Biology 2022Quote: ... All purified DNA (~20 µl) was used for PCR amplification with NEBNext High Fidelity 2x MasterMix (NEB) and optimum cycle number was determined by qPCR ...
-
bioRxiv - Cell Biology 2022Quote: Lysates (20 μg) and media immunoprecipitates were diluted to 10 μL in 2X glycoprotein denaturing buffer (NEB), and boiled for 10 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR(20 total cycles) was then carried out using the Q5 Ultra II Q5 Master Mix(NEB) to amplify final libraries using universal Illumina primers ...
-
bioRxiv - Systems Biology 2020Quote: ... that had been blocked and equilibrated into the binding buffer supplemented with 0.1% Tween 20 and 0.1μg/μl of BSA (Molecular Biology Grade, NEB). Protein-RNA complexes were then incubated with the magnetic beads on a shaker for further two hours ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μL of plasma was lyophilized and resuspended in 20 μL 1X Rapid PNGaseF buffer (NEB #P0710S) and incubated for 15 minutes at 70°C to denature proteins ...
-
bioRxiv - Genetics 2020Quote: ... The mixture was cooled to room temperature and 2 μL of 20 μM Cas9 (NEB, Ipswich, USA) was added (final concentration of 10 μM of Cas9 and 25 μM of gRNA) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A fraction of total RNA (~20 μg) was treated with DNase I (RNase-free; New England Biolabs) at 37°C for 15 min ...
-
bioRxiv - Genetics 2021Quote: ... The following day samples were digested with 20 µl of a NIaIII and PstI enzyme mix (NEB) in NEB Cutsmart Buffer at 37°C for 2 h.
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2020Quote: ... beads were resuspended in 200 μl CIP mix (20 units of calf intestinal alkaline phosphatase (M0290, NEB) in CIP buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 20 °C for 30 min to repair the DNA ends and then with Klenow exo- (NEB) in the NEB buffer 2 containing 0.2 mM dATP at 37 °C for 30 min for dA tailing ...
-
bioRxiv - Microbiology 2021Quote: ... 20 μL qPCR reactions were prepared using the LUNA® Universal qPCR Master Mix (New England Biolabs), together with 2.5 μL of ChIP DNA (1:10 ...
-
bioRxiv - Genomics 2021Quote: ... and washed several times before being resuspended the beads in 20 µl NEBuffer 2 (New England Biolabs). The final library was generated using the Illumina TruSeq kit (Illumina ...