Labshake search
Citations for New England Biolabs :
6451 - 6500 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... All of the mutations were introduced using the Q5 site directed mutagenesis kit (New England Biolabs, Ipswich, MA) with primers listed (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2022Quote: ... and Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). Index codes were added to attribute sequences to each sample ...
-
bioRxiv - Bioengineering 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA), and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Genomics 2022Quote: ... The correct size band was cut and purified with the Monarch Gel Extraction Kit (New England BioLabs T1020L). The insert single-stranded DNA was diluted to 1 μM with H2O ...
-
bioRxiv - Developmental Biology 2022Quote: ... before DNA library preparation using the NEB Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and the sequencing libraries were synthesized using a NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). Sequencing was performed using a NextSeq 500 Sequencer (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1, NEB, E7335L). Conditions for PCR used are as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs) size selection ...
-
bioRxiv - Genetics 2022Quote: ... The RNA was transcribed using 1ug of template with the HiScribe T7 Quick High Yield kit (NEB, E2050) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated using the NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA, USA) and subjected to sequencing (single-end 92× ...
-
bioRxiv - Genomics 2022Quote: ... Short-read sequencing libraries were constructed using NEBNext Ultra II DNA Library Prep kit for Illumina (NEB, USA) at the University of Melbourne ...
-
bioRxiv - Immunology 2022Quote: ... parkeri- infected ticks using the NEBNext Ultra™ RNA library Prep Kit (New England Biolabs, Ipswich, MA, USA). RNA library preparation and sequencing were conducted by Novogene Co. ...
-
bioRxiv - Genomics 2022Quote: ... 300 bp and 500 bp) were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) according to the standard protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The amplified fragment was cloned into pSEVA121 using the NEBuilder® HiFi DNA Assembly kit (New England BioLabs) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... quantified using the NEBNext Ultra RNA Library Prep Kit for Illumina (Cat No. 7530, New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded libraries were made with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75 bp reads ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, cat# E7103S) according to the manufacturer’s instructions with the following modification for bisulfite treatment ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries for sequencing were constructed using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB). The poly (A)-tailed mRNA was enriched using the NEB Next Poly (A ...
-
bioRxiv - Microbiology 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) with 1 μg of total RNAs ...
-
bioRxiv - Microbiology 2022Quote: ... and RNA-Seq libraries were generated using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Two biological replicates were sequenced using the Illumina NextSeq 550 platform to generate 150 bp PE reads ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesis was conducted via ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich MA, USA), using manufacturer’s instructions for reverse transcription of total RNA ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kit for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extracted RNA from light and heavy fractions were subjected to qRT-PCR using Luna RT-qPCR kit (NEB).
-
bioRxiv - Plant Biology 2022Quote: ... ChIPseq libraries were prepared by NEBNEXT® UltraTM II DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced using NovaSeq 6000 system (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... and a single band of the expected size was purified using Monarch Gel Extraction Kit (New England Biolabs). Purified amplicons from 6 Cas9-only control injected larva and from 24 gRNA-injected (and imaged ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and cloned into XbaI site of the pLS-mP-luc using NEBuilder HiFi DNA Assembly Cloning Kit (NEB). Fragments that failed to clone (human 2xHAR.11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized plasmid by performing an in vitro transcription with SP6 using the Hiscribe SP6 RNA kit (#E2070S, NEB) and a cap analog from the ARCA kit (#S1411 ...
-
bioRxiv - Zoology 2023Quote: ... sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Frankfurt, Germany) according to the manufacturer’s instructions without prior fragmentation ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted using the Monarch® HMW DNA Extraction Kit (New England Biolabs, T3050S and T3060S) using manufacture’s protocol for iPSC samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was synthesized from 200ng RNA using LunaScript® RT-SuperMix kit (New England Biolabs #E3010). RT-qPCR reactions were performed using Luna® Universal qPCR Master Mix (New England Biolabs #M3003) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Y350A mutations of WW domains in Yki were generated by Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554S) using pMT-yki-HA as a template ...
-
bioRxiv - Genomics 2022Quote: ... The purified product was then in vitro transcribed using “HiScribe T7 High yield RNA Synthesis Kit (NEB, E2040S) and purified using Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... histolytica RNA was prepared using the Monarch Total RNA Miniprep Kit (NEW ENGLAND BioLabs, Ornat, Nes Ziona, Israel). According to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNAseq libraries were prepared using the NEB Ultra II Directional RNA library Prep kit (New England Biolabs), with 1 ug total RNA input and initial poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 uL of Quick Ligation Buffer and 5 uL of Quick T4 Ligase (NEB Quick Ligation Kit, M2200S). The ligation reaction was incubated for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... viral cDNA was synthesized from the extracted RNA by using a LunarScript RT SuperMix Kit (New England BioLabs). The DNA was then amplified by performing a multiplexed PCR in two pools using the ARTIC-N5 primers and the Q5 Hot Start DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and further purified using a Monarch® RNA Cleanup Kit (50 μg) (NEB). RNA integrity was monitored with agarose gels ...
-
bioRxiv - Microbiology 2022Quote: ... A sequencing library was generated using the NEB Next® Ultra™ DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations and index codes were added to each sample ...
-
bioRxiv - Bioengineering 2023Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, US-CA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Systems Biology 2024Quote: ... 400 ng RNA were used as input for NEBNext Ultra RNA Library Prep Kit (New England Biolabs, USA). One sample (nonlesional skin of Pat1 ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA-Seq libraries were prepared by NebNext Ultra II RNA library preparation kit (New England Biolabs, Massachusetts, USA) and sequenced using Illumina’s state-of-the-art NovaSeq 6000 V1.5 platform (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analysed on an Illumina instrument by following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... column purified and ligated at a 1:1 vector to insert ratio using the QuickLig Kit (NEB #M2200S). The ASCL1 stop codon was subsequently mutated using the QuickChange II-XL site-directed mutagenesis kit (Agilent #200523 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sequencing libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB Catalog# E7645S) following manufacturer instructions.
-
bioRxiv - Cell Biology 2024Quote: ... RNA-seq libraries were prepared using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB). Pooled libraries were sequenced with paired end sequencing on a Novoseq 6000 by Novogene.