Labshake search
Citations for New England Biolabs :
6301 - 6350 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared according to the “NEBNext Ultra Directional RNA Library Prep kit for Illumina” (New England Biolabs) instructions and sequenced using a “NextSeq™ 500 High Output Kit” ...
-
bioRxiv - Microbiology 2021Quote: ... and dual indexed libraries were prepared using the NEBNext Ultra Directional RNA sequencing kit (New England Biolabs, USA). Libraries were sequenced on a HiSeq 4000 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: The VoC RBD mutations were introduced by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs). Successful cloning was confirmed by Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2020Quote: Site-directed mutagenesis was performed using the Q5 site-directed mutagenesis kit according to the manufacturer’s instructions (NEB). All mutations were confirmed by DNA sequencing.
-
bioRxiv - Immunology 2020Quote: ... Restriction enzymes (BamHI-HF and NheI-HF) and Quick Ligation kit were purchased from New England Biolabs (NEB). Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB). Custom DNA primers produced by Integrated DNA technologies (IDT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... in vitro transcription with T7 polymerase was done by T7 high yield RNA systhesis kit (New England Biolabs). Purification of mRNA was done by Qiagen mini column ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA libraries were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA library was constructed according to the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... Generation of the CK2K198R mutant was done using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Microbiology 2021Quote: ... followed by library preparation with NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). DNA library preparation included 6 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2021Quote: ... Catalytically inactive Mt2 (Mt2 C78A) variant was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit) using primers listed in the primer table (Table S1).
-
bioRxiv - Biochemistry 2020Quote: ... The G163H (30) and G163D variants were constructed using the Q5 site-directed mutagenesis kit (New England Biolabs) to introduce the mutation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Strand-specific libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Libraries were sequenced by paired-end sequencing with a 75 (patient samples ...
-
bioRxiv - Neuroscience 2022Quote: ... sequencing libraries were generated using a NEBNext Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... High molecular weight genomic DNA extractions were prepared using the Monarch HMW DNA Extraction Kit for Tissue (NEB). All 14 isolates cultured from DFU141 were initially sequenced with paired-end sequencing on Illumina HiSeq 2500 at PennCHOP Microbiome Core ...
-
bioRxiv - Microbiology 2022Quote: ... The synthesized ssDNA was purified using a Monarch PCR & DNA Cleanup Kit (New England Biolabs, Ipswich, MA, USA) and was eluted in ultrapure water ...
-
bioRxiv - Systems Biology 2022Quote: ... Strand-specicific libraries were created using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7760). Final libraries were quantified using qPCR and clustered at a Molarity of 300 pM ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mRNA libraries were constructed with NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs) following the manufacturer’s protocol to prepare 300-bp RNA fragments for 150 bp paired-end (PE150 ...
-
bioRxiv - Immunology 2022Quote: ... The qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with cycling conditions of 10 min at 55°C for reverse transcription ...
-
bioRxiv - Immunology 2022Quote: ... was digested with BamHI and dephosphorylated using the Quick Calf Intestinal Alkaline Phosphatase kit (M0525L, New England Biolabs). CIP was heat-inactivated and the linearized pGEX-4T1 vector was gel-purified.
-
bioRxiv - Genetics 2022Quote: ... PCR-products were gel purified after agarose gel electrophoresis with Monarch DNA Gel Extraction Kit (New England Biolabs) and submitted for sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA was collected from each fin clip using the Monarch Genomic DNA Purification kit (New England Biolabs) and amplified using OneTaq 2X Master Mix (NEB ...
-
bioRxiv - Genetics 2019Quote: ... Illumina sequencing adapters were added using the NEBNext Library Prep Kit for Illumina (New England Biolabs, Ipswitch, MA) using 1:10 diluted adapters and the optional size-selection step ...
-
bioRxiv - Microbiology 2019Quote: Sequencing libraries were prepared from genomic DNA using the NEBNext Ultra DNA Library Prep Kit (New England Biolabs) and sequenced in paired end mode on Illumina HiSeq or MiSeq machines ...
-
bioRxiv - Molecular Biology 2019Quote: ... ChIP-seq libraries were generated using NEBNext Ultra II DNA library prep kit following the manufacturer’s protocol (NEB), and sequenced on an Illumina NextSeq500 system using the 75bp high output sequencing kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplicon libraries were generated using NEBNext Ultra II DNA library prep kit following the manufacturer’s protocol (NEB), and sequenced on an Illumina NextSeq500 system using the 75bp high output sequencing kit ...
-
bioRxiv - Developmental Biology 2019Quote: ... First Strand cDNA was synthesized using the Protoscript M-MuLV First-Strand cDNA Synthesis Kit (New England Biolabs). Equal concentrations of RNA (1ug ...
-
bioRxiv - Molecular Biology 2019Quote: ... Input sample libraries were prepared using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on an Illumina HiSeq2000 at the Tayside Centre for Genomics Analysis ...
-
bioRxiv - Genomics 2019Quote: DNA whole genome libraries were prepared using NEBNext® UltraTM II DNA Library Prep Kit (#E7645L, NEB Inc). DNA was quantified on QubitTM 3.0 flourometer using Qubit High sensitivity dsDNA Assay (#Q32854 ...
-
bioRxiv - Microbiology 2019Quote: ... Sequencing libraries were prepared either by NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB) or by Accel-NGS® 1S Plus DNA Library Kit (Swift Biosciences ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
bioRxiv - Cancer Biology 2019Quote: ... NGS libraries were prepared using the NEBnext Ultra II DNA library preparation kit for Ilumina (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2019Quote: ... deletions and point mutations were introduced by Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). All constructs were transformed into NEB stable competent E ...
-
bioRxiv - Cancer Biology 2019Quote: ... while single-timepoint experiments assessing splicing required mRNA enrichment with magnetic mRNA Isolation kit poly-dT beads (NEB), then RNA Hyper Prep kit (Kapa ...
-
bioRxiv - Cancer Biology 2019Quote: ... NEBNext® UltraTM II DNA library prep kit for illumina (cat# E7645S) (New England Biolabs, Massachusetts, United States) was used for preparing the samples for sequencing and SSELXT Human All exon V6 +UTR probes (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... Purified DNA was used to prepare sequencing libraries using NEBNext UltraII DNA Library Prep Kit (New England Biolabs). Library concentration was measured by DNA High Sensitivity Kit (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... were added by using NEBNext® Ultra II DNA library prep kit for Illumina (New England Biolabs, USA). Ligation products were then purified by Ampure XP (Beckman Coulter ...
-
bioRxiv - Microbiology 2019Quote: ... and library preparation proceeded using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs, catalog #: E7530) and NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... treated according to manufacturer instructions and second-strand cDNA was synthesized using Second Strand DNA Synthesis kit (NEB) per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Then the library or pre-capture library was prepared using the NEBNext DNA library kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... probes were T7 amplified with a HiScribe T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, E2050S) supplemented with 1.3 units/μL RNaseOUT (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutations in the vector and NAA80 were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... Library preparation was carried out using an NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645) with dual-indexed multiplex i5/i7 oligo adapters ...
-
bioRxiv - Cell Biology 2020Quote: ... Correct plasmids were linearized with PvuI and used in HiScribe™ T7 ARCA mRNA Kit (with tailing) (NEB) and purified with RNA-25 Clean & Concentrator RNA purification kit (Zymo Research).
-
bioRxiv - Cancer Biology 2020Quote: ... Library preparation for whole genome sequencing used enzymatic fragmentation and the NEBNext Ultra II low input kit (NEB) with 150bp paired end on either Illumina HiSeqX or Novaseq machines ...
-
bioRxiv - Developmental Biology 2020Quote: ... ChIP-Seq library construction was done using NEBNext Ultra™ II DNA Library Prep Kit for Illumina (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... The plasmid pDD162 used to deliver Cas9 and each sgRNA was modified (Q5 Site-Directed Mutagenesis Kit, NEB) to insert the appropriate sgRNA guide sequence for each CRISPR edit ...