Labshake search
Citations for New England Biolabs :
801 - 850 of 5823 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 25 µl NEBNext HiFi 2x PCR Master mix (NEB) was added to each ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with the Taq DNA Polymerase (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were treated with DpnI (NEB, R0176) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant PCR products were introduced into NheI (NEB) linearized ToxoXpress vector (pTXP ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified PCR product was digested by BamHI (NEB) and NotI (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... and purified using Monarch PCR clean-up kit (NEB). Blunted DNA was A-tailed using NEBNext dA-tailing kit (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... and plasmid was PCR-linearized by Q5 polymerase (NEB) using primers (IDT ...
-
bioRxiv - Biophysics 2022Quote: ... and Q5 High-Fidelity PCR Kit (New England BioLabs). Plasmids were transformed in E ...
-
bioRxiv - Microbiology 2020Quote: PCR reactions were carried out using Phusion polymerase (NEB) according to the manufacturer’s recommendations with the following primers ...
-
bioRxiv - Genomics 2021Quote: ... PCR was done with the Phusion DNA polymerase (NEB), using the following program ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were digested with DpnI (New England BioLabs) overnight at 37°C and purified using Qiagen PCR Purification kit ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 were constructed by PCR (Phusion polymerase, NEB) using a full-length version of the constructs ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR was performed using Phusion high-fidelity polymerase (NEB) to add a T7 promoter sequence with custom primers (forward ...
-
bioRxiv - Microbiology 2022Quote: PCR amplicons were purified using Thermolable Exonuclease I (NEB), diluted at a ratio of 1:2 and amplified following the Nextera XT Index protocol (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and PCR was performed using Q5 polymerase (NEB; M0491L) with primers that had 500 bp homology to both KPPR1S and MKP103 on either end of the transposon cassette ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Enzymes for PCR and cloning were purchased from NEB. Plasmids were cloned into either Top10 E ...
-
bioRxiv - Bioengineering 2020Quote: ... Q5 High-Fidelity PCR Kit was purchased from NEB.
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were first treated with DpnI (NEB, R0176) and T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR-reaction was treated with DpnI (NEB CutSmart) to get rid of the template DNA ...
-
bioRxiv - Systems Biology 2021Quote: ... using 2X NEBNext High-Fidelity PCR Master Mix (NEB). For sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Both PCR reactions were digested with DpnI (NEB, USA) for one hour at 37°C and then purified using the MagJET NGS Cleanup Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification was conducted using Phusion HF reagents (NEB) and employed the following cycling conditions ...
-
bioRxiv - Genetics 2020Quote: PCR mixture per reaction: 10 µl HF Buffer (NEB), 1.25 µl 10-µM forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: PCR-1 reactions were performed using Q5 Polymerase (NEB) in a 20 μl reaction containing 200 μM dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were digested with BsaI (New England Biolabs) followed by gel purification and ligation into respective entry vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Phusion polymerase (NEB #M0531S), run on an agarose gel ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were conducted using Phusion polymerase (NEB) according to the manufacturer’s instructions with GC buffer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were made with Phusion polymerase (NewEngland Biolabs) under the standard reaction protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR product was purified on silica columns (NEB T1034) and assembly with Nluc_HBB_3UTR fragment was performed as described above for initial preparation of IVT template using HBB29_N35 amplicon ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR product was purified on silica columns (NEB T1034) and amplified with under the following conditions ...
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... The HeLa Deletion Reporter required PCR with OneTaq (NEB) using the high GC content additive to amplify through the very GC-rich CAG sequence ...
-
bioRxiv - Microbiology 2021Quote: ... The backbone PCR products were subjected to DpnI (NEB) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were prepared with OneTaq Master-mix (NEB) in 96 well plates to a final volume of 20μl ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR amplicon was digested with Nde I (NEB) and Xho I (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR fragments were obtained using Phusion polymerase (NEB M0530L) with 37 cycles at 98°C for 30s ...
-
bioRxiv - Immunology 2021Quote: ... The PCR was performed using Phusion DNA polymerase (NEB) and DMSO 10% ...
-
bioRxiv - Immunology 2020Quote: ... PCR products were digested by Dnp1 (New England Biolabs). After Quick Change ...
-
bioRxiv - Cell Biology 2021Quote: ... The clones were then screened by PCR (Q5-NEB) and amplified to be further analysed by western blot.
-
bioRxiv - Cancer Biology 2021Quote: ... The radiolabeled PCR product was digested with PstI (NEB) for 2 hrs at 37 °C to distinguish PKM1 (undigested ...
-
bioRxiv - Immunology 2021Quote: ... directly into One Step RT-PCR reaction mix (NEB) loaded in MicroAmp Optical 96-well reaction plates (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified with the Monarch PCR & DNA Cleanup Kit (NEB) and ligated with T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was digested with Kpn I (NEB) and Hind III (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Colony PCR reactions were performed with Taq polymerase (NEB). QiaQuick PCR purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μL NEBNext HiFi 2 × PCR Master mix (NEB) was added ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR product was incubated with DpnI (NEB, USA) in 1 hour at 37°C to digest the template plasmid.
-
bioRxiv - Microbiology 2022Quote: ... whereas diagnostic PCR used standard Taq DNA polymerase (NEB).
-
bioRxiv - Systems Biology 2023Quote: ... gDNA was amplified by PCR with Phusion polymerase (NEB) using primers CAAGCAGAAGACGGCATACGAGAT -i7 - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCACTGCTAGCTAGATGACTAAACGCG and AATGATACGGCGACCACCGAGATCTACAC - i5 - ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGGTCTGGATCCACCGGTCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were circularized with T4 kinase (NEB, M0201L) and T4 ligase (NEB ...