Labshake search
Citations for New England Biolabs :
5851 - 5900 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... the Monarch Genomic DNA Purification kit (New England Biolabs) was utilized with 1-2 x 106 cells ...
-
bioRxiv - Microbiology 2024Quote: ... spin purified with DNA clean and concentrate kit (NEB), and sequenced with Plasmidsaurus.
-
bioRxiv - Molecular Biology 2024Quote: The Q5 Site-Directed Mutagenesis Kit (New England Biolabs) was used to introduce the mutations into pET15b plasmid-borne copies of PRX1 and TRX3 genes using pairs of adequate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Monarch® RNA Cleanup Kit (New England Biolabs) was used to purify transcribed RNA strands ...
-
bioRxiv - Microbiology 2024Quote: ... the NEBNext Ultra II DNA Library Prep Kit (NEB) was used according to the manufactu er’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... a Quickchange site-directed mutagenesis kit (New England Biolabs) was used to introduce the F405L and K409R mutations in the HC plasmids of the IgGs to make the bsAbs ...
-
bioRxiv - Cancer Biology 2021Quote: ... Kras cDNA was amplified in PCR reaction using the corresponding primers (Reagents) and Phusion Hot Start Flex polymerase (New England Biolabs, Ipswich, MA). cDNA fragments were purified with NucleoSpin gel and PCR clean-up columns (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2020Quote: ... This was immediately followed by ligation of Illumina adaptors and PCR amplification (for 9-12 cycles) using Illumina barcoding primers and Phusion DNA polymerase (NEB, Cat# M0530S). PCR products were double size-selected using the KAPA Pure beads (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... the genes were PCR-amplified using primers containing cut sites for the restriction enzymes EcoRI (forward) and SalI (reverse) (New England Biolabs, NEB, Australia) for gtr29 ...
-
bioRxiv - Genetics 2021Quote: Transposase reactions were initially amplified by 8 cycles of PCR using primers described by Buenrostro et al (2013) and 2X NEBNext Q5 HotStart HiFi Master Mix (New England Biolabs, Cat# M0543). Amplicons of 175 -250bp were size-selected using agarose gel electrophoresis on BluePippin 2% gel cassettes (Sage Science ...
-
bioRxiv - Developmental Biology 2021Quote: ... Amplification of cDNA ends was carried out using step-out PCR as previously described (Matz et al., 2003) with the Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA).
-
bioRxiv - Developmental Biology 2021Quote: ... Probes for Po-EgfrA were synthesized from a PCR template using universal T7 primers and T7 polymerase (New England Biolabs, MA, USA). RNA probes for Popi-Dfd were synthetized from the plasmid template of Popi-Dfd3’ using T7/T3 RNA polymerase (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... The M1879T mutant channel was constructed using site-directed mutagenesis PCR (Forward primer: AATACAGACGGAAGAGCGATTCATGGCATCAAACCC; Reverse primer: GCTCTTCCGTCTGTATTCGAAGGGCATCCATCTCTCC) with Q5 polymerase (New England Biolabs, Ipswitch, MA). The neonatal construct differed from the adult by inclusion of the neonatal exon 6N instead of the adult exon ...
-
bioRxiv - Developmental Biology 2020Quote: ... RFP-histone H2B fusion protein (pRN3-C-term-RFP-Hist1h2bb) derived by in frame cloning of a high-fidelity PCR amplified cDNA (Phusion® DNA polymerase, New England BioLabs, M05305) encoding histone H2B (Hist1h2bb ...
-
bioRxiv - Developmental Biology 2020Quote: The lft2 exon regions were amplified by PCR from genomic DNA isolated from tail fin clips of a surface fish and individual F61 PA-CF male and females using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA) and the primers listed in Table S3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mlrA gene was amplified from the MlrA-expression plasmid pASKA-MlrA (Table EV2) by PCR using Phusion High-Fidelity DNA polymerase (New England Biolabs, Tokyo, Japan) and the primer set Pure-Niwa-F and Pure-Niwa-R (Table EV3) ...
-
bioRxiv - Genetics 2019Quote: ... Amplification of the coding sequence and 7 kb of surrounding non-repetitive sequence was performed with a nested PCR design to obtain specificity using NEB Longamp polymerase (New England Biolabs, Ipswich, MA). The region was divided into 2.5 kb and 4.5 kb regions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
Weak Membrane Interactions Allow Rheb to Activate mTORC1 Signaling Without Major Lysosome EnrichmentbioRxiv - Cell Biology 2019Quote: ... Full length Rheb was PCR amplified from this vector and cloned into Smal-digested pEGFPC1 by Gibson Assembly (New England Biolabs, Ipswich, MA). The Q5 Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2019Quote: ... NG-Stop was created using the same inverse PCR product as NG-Scarlet and NG-Cherry via blunt end ligation using NEBs KLD Mix (New England Biolabs; Ipswich, MA). The mNeonGreen gene was obtained from the pmNeonGreen-NT plasmid (Allele Biotehcnology ...
-
bioRxiv - Microbiology 2019Quote: Desired sequences were amplified from genomic DNA of Escherichia coli O157:H7 EDL933 in a PCR (Q5 polymerase, NEB, Ipswich, Massachusetts, USA) using different primer pairs ...
-
bioRxiv - Genomics 2019Quote: ... PCR reactions for library preparation were performed by adding the following to the 10 μL DNA sample: 25 μL of Phusion High-fidelity PCR Master Mix (NEB catalog # M0531S), 1 μL of 5’ library index barcode ...
-
bioRxiv - Systems Biology 2019Quote: ... The cDNA inserts were PCR-amplified using primers specific for either the N- or C-terminal libraries using Phusion DNA polymerase (New England Biolabs, Ipswich, MA). Amplicons were PCR-purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: Targeted sequencing for specific off-target or on-target sites was performed via a standard 2-step PCR using gene-specific primers with adaptors in the first round of PCR amplification and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (New England Biolabs) for the second round of PCR amplification ...
-
bioRxiv - Genetics 2021Quote: ... Supernatant containing genomic DNA was used as a template for the PCR amplification of the 16S rRNA gene using Taq polymerase (New England Biolabs, Ipswich, MA) and the primers oMC98f (5’-GAAGAGTTTGATCATGGCTC-3’ ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Unique barcoded adaptor sequences were ligated to each sample of tagmented gDNA with 14 cycles of PCR using OneTaq 2x Master Mix (NEB, cat# M0482S), and all samples were pooled into a single multiplexed sequencing library ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic DNA from cells collected at T0 and T18 was isolated as previously described [54] and sgRNA sequences amplified by PCR using Q5 Mastermix Next Ultra II (New England Biolabs, Cat# M5044L) with the following primers ...
-
bioRxiv - Biophysics 2021Quote: ... Homology arms of ~800 bp were amplified from genomic DNA using PCR primers with 40 bp overhangs compatible with pUC19 backbone digested with Xba1 and Ecor1 (New England Biolabs, Ipswich, MA) (sequences in the table below) ...
-
bioRxiv - Bioengineering 2021Quote: ... Cloning of PCR products and gBlocks in the pKSB- intermediate vector 43 was performed using NEBuilder® HiFi DNA Assembly (New England Biolabs, France) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... the Irk1WT and Irk1V306A open reading frames were amplified from pENTR-Irk1WT or pENTR-Irk1V306A by PCR (Phusion high-fidelity DNA polymerase, New England Biolabs Cat #M0530). Primers pAc5-Irk1-F and pAc5-Irk1-R included additional sequence for subsequent Gibson assembly cloning into the multi-cistronic vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Twenty-four PCR reactions (24 x 50 μl) were performed with 1 U of Q5 high-fidelity polymerase (New England Biolabs®, M0491), 200 μM dNTPs ...
-
bioRxiv - Plant Biology 2021Quote: ... The F1 fragment of eYGFPuv was assembled by cloning the gblocks and a PCR-amplified relevant fragment into an eYGFPuv vector 10 through NEBuilder HiFi DNA Assembly (New England BioLabs, Catalog #E5520S). Similarly ...
-
bioRxiv - Biochemistry 2021Quote: ... Vectors used to construct plasmids containing the bbu genes were linearized by PCR amplification from 10 ng vector template DNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). Thermocycling was carried out in a Bio-Rad C100 thermal cycler using the following parameters ...
-
bioRxiv - Biochemistry 2021Quote: ... timonensis SN18 gDNA in a 50 μL reaction containing 0.5 μM of forward and reverse primers (Dataset S5) and Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs, Ipswich, MA). A plasmid based on the pET28a(+ ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Neuroscience 2019Quote: ... Clones were screened for Phf15 deletion using PCR (primers Forward: agcacacttgtaaccctcct and Reverse: gaccaatgtctgttgttgttcg) followed by restriction digest with BtgI (New England Biolabs, Ipswich, MA). Percent decrease in Phf15 mRNA transcript expression was determined via RT-qPCR (primer sequences are listed in Supplementary Table 1).
-
bioRxiv - Biophysics 2021Quote: ... a variable 89-bp hairpin stem capped by a (dT)4 tetraloop was ligated to two 1.5-kb double-stranded “handles” made by PCR amplification of sections of the pBR322 plasmid (New England Biolabs, Ipswitch, MA, USA). The left and right handles were respectively modified with 5’ biotin and digoxigenin to facilitate attachment to streptavidin- and anti-digoxigenin antibody-coated beads ...
-
bioRxiv - Neuroscience 2022Quote: ... SARS-CoV-2 cDNA was subsequently amplified using ARTIC network v2 primers using two-step PCR amplification with Q5® High-Fidelity DNA Polymerase (New England Biolabs, USA). PCR fragments were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Single primer PCR was performed in 2 different tubes for each plasmid using Q5 2X Master Mix (New England Biolabs Cat.No M0492S). After the amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR was carried out on 100 ng of gDNA per sample using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Hitchin, UK) with an initial denaturation phase (98°C for 30 seconds) ...
-
bioRxiv - Microbiology 2022Quote: ... colony PCR was conducted to amplify the 5’ IGR of the major T6 cluster using OneTaq DNA Polymerase (New England Biolabs – MA, USA). PCR products were confirmed with gel electrophoresis and Sanger sequencing by Eton Bioscience Inc ...
-
bioRxiv - Immunology 2022Quote: ... The PCR enrichment of adaptor-ligated DNA was conducted with 7 cycles and NEBNext® Multiplex Oligos for Illumnina® (NEB, USA) for single end barcoding ...
-
bioRxiv - Immunology 2022Quote: ... the tdTomato gene (codons optimized for expression in C. burnetii) was amplified by PCR with Q5 polymerase (New England Biolabs, Frankfurt, Germany) using primers a533 (5’-GATTTAAGAAGGAGATCTGCAGATGGTGTCAAAAGGAG-3’ ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... The template for probe synthesis was generated through two rounds of standard PCR method using OneTaq® 2x Master Mix (New England Biolabs, NEB): the first PCRs from cDNA used the gene-specific primers including the T7 linker sequence ...
-
bioRxiv - Microbiology 2021Quote: ... The construct was amplified by 2-step PCR according to manufacturer recommendations using Q5 high fidelity polymerase (New England Biolabs, cat#M0494S) with primers 6469TSC and 6470TSC (Supplemental table 1) ...
-
bioRxiv - Immunology 2020Quote: ... with Poly(A) mRNA Magnetic Isolation Module (CAT#E7490S) and index PCR primers (CAT #s E7335, E7500) (New England Biolabs; Ipswich MA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and PCR products were digested with DpnI to eliminate plasmid template before setting up the assembly reaction (New England BioLabs, MA, USA). Finally ...
-
bioRxiv - Immunology 2019Quote: ... Then sgRNA template for in vitro transcription (IVT) was prepared by PCR amplification of Phusion high fidelity DNA polymerase (NEB Biolabs, Ipwich, MA), the PCR mixture was cleaned up by PCR cleanup reaction (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... 3 μl from 100 μl of enzymatically converted and 1 μl from 15 μl of bisulfite-converted DNA were PCR amplified with Q5U polymerase (NEB, Ipswich, MA) and primers (Supplemental Table 3 ...