Labshake search
Citations for New England Biolabs :
6051 - 6100 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... The full length ayRhp1 sequence was obtained following two rounds of RT-PCR using Phusion High Fidelity taq polymerase (New England Biolabs, Ipswitch, MA, USA) and NucleoSpin gel purification (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2020Quote: ... which were either digested with restriction enzymes purchased from New England Biolabs (Ipswich, MA, USA) or were used as a template for PCR using Q5 High-Fidelity Polymerase (New England Biolabs, Ipswich, MA, USA). The plasmid pEG1675 developed by Goh et al ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids made in this study were constructed using G-blocks™ and/or PCR products and assembled using NEBuilder® HiFi DNA Assembly Master Mix following manufacturer’s protocol (NEB, Ipswich, MA). Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB ...
-
bioRxiv - Genetics 2019Quote: The DNA fragment of the synthetic sgRNA expression cassettes was PCR amplified with high fidelity Taq DNA polymerase (NEB Phusion® Cat#M0530S) using the forward and reverse primers 5’-aggctcccgggtgcgtcgacggtctcaggtcagagcttg-3’ and 5’-gaaagctgggtgattcaagcttggtctcatcagggatccaaaag-3’ respectively ...
-
bioRxiv - Microbiology 2019Quote: ... Then deoxycytosine homopolymer tail (C-tail) was added to the linear extension purified PCR product using Terminal Transferase (TdT, New England Biolabs, Ipswich, MA, USA) enzyme following previous protocol (Lazinski and Camilli ...
-
bioRxiv - Genomics 2021Quote: Duplicate PCR reactions were set up for each sample with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Ipswich, MA, USA) in a 15 μL reaction volume ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA (2.5 μL) was amplified in two multiplexed PCR reactions using Q5 Hot-Start DNA High-fidelity Polymerase (New England Biolabs, Ipswich, MA, USA) using the following cycling conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product and pBR43IeG-nef+ (NIH AIDS reporter clone #11349) were then digested with NcoI and XmaI (New England Biolabs, Ipswich, MA, USA). The digested products were separated by 0.8% agarose gel electrophoresis and purified using the Monarch® DNA Gel Extraction Kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of this PCR product and pKLV-U6gRNA(BbsI)-PGKpuro2ABFP was digested with MluI and BamHI (New England Biolabs, Ipswich, MA, USA). The digested products were purified ...
-
bioRxiv - Genetics 2019Quote: ... These cDNA templates were amplified through 23-30 cycles of PCR using Phusion High-Fidelity master mix (New England Biolabs, Ipswich, MA, USA). For MHC class I sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: Recombinant expression plasmids were constructed by PCR amplification of both vector and insert sequences using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) followed by a Gibson assembly reaction using NEBuilder HiFi DNA Assembly Cloning Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... all PCR products were assembled into the pSK275 backbone using the NEBuilder HiFi DNA assembly Master Mix (New England Biolabs, Ipswich, MA, USA), and the constructs were propagated in E ...
-
bioRxiv - Genomics 2022Quote: The linear vector used in the ATAC-STARR-seq gibson cloning step was generated by a single 50μL PCR reaction using NEBNext® Ultra™ II Q5® Master Mix (NEB, #M0544S). While not necessary for this study ...
-
bioRxiv - Microbiology 2022Quote: ... magnetosome genes were PCR amplified from the G2-11 genome using the high-fidelity Q5® polymerase (New England Biolabs, New England USA) and cloned by restriction sites into the pBamII-Tc vector (Supplementary Table S4) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the pGL3 Basic vector and T/F LTR U3R PCR products were digested with KpnI and HindIII (New England Biolabs, Ipswich, MA, USA), individually as per manufacturer’s instruction ...
-
bioRxiv - Zoology 2024Quote: The complete open reading frames of AedaeCCHa1R and AedaeCCHa2R were amplified by PCR using Q5 high-fidelity DNA polymerase (New England Biolabs, Whitby, ON, Canada) with primers located upstream of the start codon and downstream of the stop codon (Supplement Table S1 ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments for plasmid construction were amplified using Q5 DNA polymerase and colony PCRs were performed with OneTaq 2X Master Mix (New England BioLabs, Ipswich, Massachusetts, USA).
-
bioRxiv - Immunology 2024Quote: ... The 16S rRNA gene spanning variable regions V3+V4 was amplified using the broad-range forward primer 341F: CCTAYGGGRBGCASCAG and the reverse primer 806R: GGACTACNNGGGTATCTAAT using the Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program consisted of (1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: We cloned the error-prone PCR library into pMR1 at the EcoRI and BamHI sites using NEBuilder (New England Biolabs, USA, product #E2621) as follows ...
-
bioRxiv - Genomics 2024Quote: ... and half the elution was used as a template in a second round of 8-10 cycle PCR to prepare Illumina libraries using NEBNext multiplex oligos using the same conditions described above (NEB E7335L and E7500L). The final PCR product was purified using AMPure XP beads (Beckman Coulter A63882 ...
-
bioRxiv - Genomics 2024Quote: ... samples containing a mixture of single-cell ATAC and RNA libraries were resuspended in the pre-amplification mastermix containing 1x NEBNext HF 2x PCR Master Mix (NEB, catalog no. M0541L) and a combination of three primers ...
-
bioRxiv - Immunology 2024Quote: ... The following PCR primers were used to amplify cut sites with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA): IRF4 5’ - AGGTGCCTTCTTCCGGGG – 3’ & 5’ - TTGCGTGGAAACGAGAACGC – 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR fragments were cloned into plasmid via Golden Gate with BsaI-HF v2 or Gibson assembly (New England Biolabs, Gibson Assembly Protocol (E5510)) ...
-
bioRxiv - Microbiology 2023Quote: ... the plasmid backbone was amplified by PCR using primers P9 and P10 and the Q5 DNA polymerase (New England Biolabs, USA, NEB #M0491). These primers were obtained from Eurofins Genomics (Germany ...
-
bioRxiv - Biochemistry 2023Quote: ... and then the two PCR products were co-transformed into yeast along with pCB05 digested with BstXI (New England Biolabs [NEB], Catalog # R0113S) and XhoI (NEB ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Genomics 2023Quote: ... The purified product was then used as template for a subsequent amplicon PCRs using 0.5 U Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) 0.5 U ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MYPT1 and PKA-R and fragments thereof were amplified by PCR using Q5® High-Fidelity DNA polymerase (New England Biolabs, Herts, UK) and subcloned into appropriate vectors for expression as Myc tag fusions in mammalian cells or for expression in E ...
-
bioRxiv - Plant Biology 2023Quote: ... Successful insertion of each gblock in the correct orientation was confirmed by restriction digest and PCR amplification using Q5 polymerase (New England Biolabs, Ipswich, MA, USA) followed by Sanger sequencing of plasmid DNA in the Cornell University Institute for Biotechnology (Ithaca ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR-amplified ispA(S80F) and tObGES were then assembled with the restriction-digested pCDFDuet1-kanR (BamHI and XhoI) (NEB, Ipswich, MA, USA) using the Gibson method to create the pCDFDuet1-kanR_PT7-lacO-ispA(S80F).tObGES ...
-
bioRxiv - Plant Biology 2023Quote: ... and terminator (269 bp downstream) was polymerase chain reaction (PCR)–amplified from K60 gDNA and cloned via Gibson Assembly (New England Biolabs, Ipswich, MA, USA) at the HindIII site of pUC18miniTn7Gm to create pUC18miniTn7Gm::ripUK60 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...
-
bioRxiv - Genetics 2023Quote: ... and PCRs to define the structure of the MRP3 alleles were performed using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Massachusetts, USA), according to the manufacturer’s instructions using the primers reported in Russo et al ...
-
bioRxiv - Genomics 2024Quote: The 493 gRNAs with associated 10N random barcodes were ordered as an IDT oPool and PCR amplified with Q5 High-Fidelity polymerase (NEB, Cat. No. M0491S) to make double stranded DNA ...
-
bioRxiv - Microbiology 2024Quote: ... SARS-CoV-2-specific amplicons were generated using xGen Artic V4 NCoV-2019 primers (Integrated DNA Technologies Inc., Coralville, Iowa) and Q5 Hot Start High Fidelity PCR Master Mix (New England Biolabs, Cat. no. E0555S). Sequencing libraries were prepared using NEBNext ultra II DNA library kit (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Escherichia coli and Myxcococcus xanthus were amplified from genomic DNA by PCR (Q5® High-Fidelity 2X Master Mix, New England Biolabs, USA-MA) and introduced into the pLIC expression vector55 by Gibson cloning (Gibson Assembly Master Mix ...
-
bioRxiv - Evolutionary Biology 2024Quote: Target amplicons were amplified by polymerase chain reaction (PCR) from the cDNA of slow swimmer and thecate cultures (Fig. S2A) with the Luna Universal qPCR Master Mix (NEB, Cat, No. M3003). The amplicons were run on a 1% (w/v ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ssDNA standards were generated from PCR products amplified with a forward primer that was 5’ phosphorylated to promote Lambda exonuclease digestion of that strand (NEB, Cat. No. M0262S) and a reverse primer with phosphorothioate bonds between the first four 5’ nucleotides to block digestion ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA (transfected plasmid DNA) and plasmid DNA samples (that was used for transfection) with Phusion High-Fidelity PCR Master Mix (NEB Catalog no. M0531S) using primer set KC_BC (Table S4 ...
-
bioRxiv - Genetics 2024Quote: ... An amplicon DNA library was made by designing amplicons to the coding regions of NR1H3 and PCR was undertaken using Q5® Hot Start High-Fidelity 2X Master Mix (Catalogue number M0494S, New England Biolabs® Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB), and NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the Q5® site-directed mutagenesis kit (New England Biolabs) was used on the Patgl-1::GFP plasmid previously generated (Noble et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Cypridina Luciferase Assay Kit (New England Biolabs) and Gaussia luciferase was assayed from 1:40 diluted cell culture supernatant using either the Stop & Glo reagent from the DualLuciferase® Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Gaussia Luciferase Assay Kit (New England Biolabs) in a Lumat LB 9507 luminometer (Berthold Technologies).
-
bioRxiv - Immunology 2021Quote: ... NEXTFLEX barcodes were ligated using the Quick Ligation Kit (NEB). Libraries were amplified for 15 cycles using HotStart HiFi Ready Mix (KAPA) ...
-
bioRxiv - Immunology 2021Quote: ... and NEBnext Ultra II RNA library prep kit (NEB E7770S). Briefly ...