Labshake search
Citations for New England Biolabs :
5901 - 5950 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The V4 hypervariable region of the 16S rRNA bacterial gene (515-806) was amplified using specific primers with the barcodes with Phusion High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA). PCR amplicons from each sample were pooled in equimolar amounts and purified using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were pooled and treated for 1 hr at 37°C with 25 U of Exonuclease I (NEB, Cat# M0293S) per 100 μL of pooled PCR reactions ...
-
bioRxiv - Genetics 2022Quote: The full-length ccf-1 cDNA clone was generated through PCR using the Q5® High-Fidelity DNA polymerase (New England BioLabs, M0491L) and cloned into the pDEST32 vector containing the GAL4 DNA binding domain (DBD ...
-
bioRxiv - Immunology 2022Quote: ... together with protease cleavage sites and restriction sites between the matrix and capsid domains of Gag of the full-length SIVMAC239 proviral DNA using PCR and the NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA) and used the same strategy as Hubner et al to generate the HIV Gag-iGFP 18 ...
-
bioRxiv - Genomics 2022Quote: ... The mCherry cassette was cloned using G-block double-stranded DNA fragments synthesized by Integrated DNA Technologies (IDT) and PCR products generated using Q5 DNA polymerase (New England Biolabs, Cat#: M0492). The mCherry coding sequence was synthesized with silent mutations ablating potential splice donor and splice acceptor sites that could interfere with intended splicing of the intron ...
-
bioRxiv - Developmental Biology 2022Quote: ... the PCR products (primers shown in Table S1) were digested with AvaII and HpyCH4IV restriction enzymes (New England BioLabs; Ipswich, MA, USA), respectively ...
-
bioRxiv - Synthetic Biology 2022Quote: ... encoding a 7-mer insertion between amino acid residues 588 and 589 of AAV9 was used as the reverse primer along with the Assembly-Xbal-F oligo (CACTCATCGACCAATACTTGTACTATCTCT) as a forward primer in a PCR reaction using Q5® High-Fidelity 2X Master Mix (NEB #M0492S) following the manufacturer’s protocol for 30 cycles with 10 ng pUC57-wtAAV9-X/A plasmid.
-
bioRxiv - Microbiology 2019Quote: ... A high fidelity PCR was performed with the same 16S primers but using Q5 Hot start 2x master mix (New England Biolabs, Hitchin, U.K.). After amplification ...
-
bioRxiv - Plant Biology 2019Quote: ... the sequence encoding PL1 (with no stop codon) was amplified using standard PCR reactions with a high fidelity Phusion Taq polymerase enzyme (New England Biolabs, Hitchin, UK) and appropriate templates ...
-
bioRxiv - Genetics 2020Quote: ... V416I and S438N were modified by site-directed mutagenesis PCR using Phusion®High-Fidelity DNA Polymerase (New England Biolabs, Massachusetts, USA). pGEMHE constructs were linearized using sbfI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... ∼1 kb regions containing the gRNA target were amplified using appropriate PCR primers (Table E2) and Q5 DNA Polymerase (New England Biolabs, Ipswich, MA) and purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA substrates used for digestion reactions were either generated by PCR using Q5® High-Fidelity 2X Hot Start Master Mix (NEB #M0494), oligonucleotides produced by IDT ...
-
bioRxiv - Genetics 2020Quote: ... This exonuclease-treated Klenow amplification was then used as a template in a standard 15-cycle PCR (Taq 2X Master Mix; New England Biolabs, MA. USA) using Illumina IDT-NXT primers carrying dual indexes (Supplemental Data 4).
-
bioRxiv - Synthetic Biology 2020Quote: PCR amplicons were randomly fragmented to an average size of 150-200 bp using NEBNext dsDNA Fragmentase (New England Biolabs, cat. M0348S), following manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homology arms were assembled into digested (SacI, XbaI) or PCR-amplified pLO3 backbone via Gibson Assembly (HiFi, NEB or In-fusion, Takara). C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... individual oligo libraries were PCR-amplified using 15 nt amplification primers with Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA), and number of cycles determined by qPCR ...
-
bioRxiv - Pathology 2020Quote: ... Candidate colonies were screened using external primers (Table S1) by PCR using Phusion HiFi polymerase according to the manufacturer’s instructions (New England BioLabs, Ipswich, MA, USA). Candidates with the expected PCR fragment size were sequenced using external primers to confirm the knock-out of the gene fragment.
-
bioRxiv - Microbiology 2021Quote: ... PCR with Taq polymerase was performed in a 25-μl volume tube following the manufacture’s guidelines (New England Biolabs, Ipswich, MA, www.neb.com). PCR amplicons were visualized by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed in a final volume of 50 μL: 25 μL of Q5 polymerase master mix (New England Biolabs, MA, USA), 10 μL of GC enhancer buffer (New England Biolabs) ...
-
bioRxiv - Genetics 2021Quote: ... PCR products with homologous DNA sequences (1 to 1.5 kb) flanking the deleted region were PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB, Ipswich MA, USA). These flanking PCR products were fused to two sides of either a NEO or NAT dominant selectable marker via overlap PCR ...
-
bioRxiv - Genomics 2021Quote: ... thirty-two 50 µl PCR reactions were performed using 500 ng genomic DNA for each reaction and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, M0541S). The purified libraries were sequenced on the NovaSeq 6000 with 150-bp paired-end sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Full-length cDNA sequences were obtained in 35 cycles of PCR reactions with Phusion DNA polymerase (New England Biolabs, Ipswich, USA; MO531L) and specific primers designed against the sequence of the phylogenetically characterized white seabass β-NHE obtained from the combined gill and RBC transcriptome (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana IMPa-4 fragment were used for genomic PCR and followed by digestion with BamHI and XhoI (New England Biolabs, Ipswich, MA). The pTRV2 vector (ABRC ...
-
bioRxiv - Developmental Biology 2020Quote: ... Inverse PCR was performed on the ligated genomic DNA using Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA, USA). PCR products underwent primer walking Sanger sequencing (Sterky and Lundeberg ...
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Cell Biology 2021Quote: ... YCplac111-Pah1-PrtA was linearized by inverse PCR and re-ligated using the NEBuilder HiFi DNA assembly mix (New England Biolabs, Ipswitch, Massachusetts) so that the Protein A sequence was replaced by a triple HA sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... primers 1 - 3) and then inserting the resulting PCR product into BamHI-digested pBMN-mCherry using Gibson assembly (New England Biolabs, Ipswich, MA). The resulting pBMN-ARHGAP36-mCherry vectors with XhoI and SacII restriction sites were subsequently used in all experiments described herein.
-
bioRxiv - Cell Biology 2020Quote: ... TopBP1 full-length cDNA (a kind gift from Lee Zou) was amplified by PCR with primers 1 and 2 using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, CM0530). The forward and reverse primers contain AscI and NotI sites ...
-
ER exit sites in Drosophila display abundant ER-Golgi vesicles and pearled tubes but no megacarriersbioRxiv - Cell Biology 2021Quote: ... Gel purified PCR product soo-XbaI-Gateway-XbaI-soo was then cloned into pTGA linearized by XbaI digestion (New England Biolabs, cat#R0145S) using SoSoo mix reagent (TreliefTM SoSoo Cloning Kit ...
-
bioRxiv - Immunology 2021Quote: ... was isolated from cDNA of devil peripheral blood mononuclear cells (PBMCs) by PCR using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2020Quote: The viral nucleic acids detected by PCR of the LTR-gag region were digested with the restriction endonuclease ScaI (New England BioLabs, Beverly, MA), which cuts within the amplicon of HIV-2287 but not SIVmne ...
-
bioRxiv - Immunology 2020Quote: ... The heavy and light chain PCR products were cloned in frame with seamless cloning using the NEBuilder® HiFi DNA Assembly Master Mix (NEB, UK) after linearizing the vectors with KpnI (5’ ...
-
bioRxiv - Immunology 2021Quote: ... 62 was modified to introduce IL6 secretion signal (IL6ss) upstream of Myc-Nluc using PCR-based approach with NEBuilder DNA assembly (New England Biolabs, Ipswich, MA). Lentiviral helper plasmids expressing HIV Gag-Pol ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutant libraries were constructed via overlap extension PCR and standard ligation using T4 DNA ligase (New England Biolabs, Beverly, MA). Oligonucleotide primers carrying NNB base triplets were purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Amplicons of tagged-Cdep were isolated by gel extraction after PCR amplification using Phusion high fidelity polymerase (New England Biolabs, catalog #E0553L). The amplicons were then cloned into the pJFRC7 5x UAS vector (ref ...
-
bioRxiv - Genomics 2022Quote: The bead-bound ligation products were amplified 8-13 cycles by PCR (Supplementary Information Table 5 for cycle recommendations according to starting cell number) using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L)
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Genetics 2022Quote: ... The reaction mixture was composed of a PCR-ready mix (using NEBNext® Ultra™ II Q5® Master Mix, NEB, M0544L), a cell lysis product ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was subjected to qRT-PCR analysis using the Luna Universal qPCR Master Mix Protocol (New England Biolabs, Frankfurt am Main, Germany) and a CFX96 Real-Time System ...
-
bioRxiv - Neuroscience 2023Quote: ... Digested backbone and PCR amplified fragments were joined via seamless cloning (NEBuilder® HiFi DNA Assembly Master Mix, NEB, Cat. No. E2621S). Assembled plasmid was Sanger-sequenced to ensure correct assembly and reading frame ...
-
bioRxiv - Synthetic Biology 2022Quote: ... vectors were from Park and Kim.11 The AtADT2 sequence and pHyo182 backbone were PCR-amplified and Gibson-assembled (NEB, Ipswich, MA). The S222N mutant of AtADT212 was recreated by site-directed mutagenesis (Q5® Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was performed with 2 μl of the reverse transcription positive reactions and Phusion High Fidelity DNA polymerase (NEB, Ipswich, MA) following manufacturer’s protocols on an Applied Biosystems 2720 Thermal Cycler ...
-
bioRxiv - Cell Biology 2022Quote: ... PRR14 1-212 PCR products were sub-cloned into the expression vector pCMV6-AN-mGFP using T7 ligase (New England Biolabs, cat# M0318S) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... approximately1-kb regions upstream and downstream regions of a target gene were amplified by PCR and assembled with BamHI-cut pJQ200sk using the NEBuilder HiFi DNA assembly system (New England Biolabs, Ipswich, MA) to generate a suicide plasmid ...
-
bioRxiv - Systems Biology 2024Quote: ... The dsRNA sequence region of each gene was amplified with the gene-specific primer pair using Q5 high-fidelity PCR (New England BioLabs, Ipswich, MA). The sense and antisense dsRNA sequence fragments conjugated with the T7 promoter sequence were amplified separately using the previous PCR amplicons as templates ...
-
bioRxiv - Neuroscience 2023Quote: ... Up to 10 ng of gDNA was amplified in a 20 μl volume using NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) supplemented with 5% dimethyl sulfoxide and barcoded primers specific to HTT Exon 1 (0.5 μM each ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was incorporated into a digested pFLP2 backbone using KpnI and BamHI restriction sites and HiFi ligation mix (NEB, Ipswich, MA). All restriction enzymes are from NEB (Ipswich ...
-
bioRxiv - Microbiology 2023Quote: ... 30 μL of the PCR product was added directly to a 50 μL in vitro transcription reaction with T7 RNA Polymerase (New England Biolabs, Beverly, MA) according to the manufacturer’s instructions and incubated for 3h at 37 ℃ ...
-
bioRxiv - Microbiology 2024Quote: ... isolated DNA from MPA/xanthine selected parasites was PCR amplified using GRA6 primers and the purified amplicon was fragmented with MseI (NEB cat# R0525M). Products were run on a gel to determine parasite type I or III based on unique fragmentation sizes indictive of the genotype.
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae REV7 gene was amplified from genomic DNA by PCR using the primer pair (forward OSB01 and reverse OSB02) and Phusion DNA polymerase (NEB, Ipswich, MA) as described (Sambrook and Russell ...