Labshake search
Citations for New England Biolabs :
5651 - 5700 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The fragments containing Himar transposons were enriched with a two-step nested PCR strategy using Q5 DNA polymerase with GC enhancer (New England Biolabs, M0491) using primers (Table S7 ...
-
bioRxiv - Microbiology 2023Quote: ... 1990) tagged with Illumina adapters in PCR reactions using a Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). The 25 amplification cycles were as follows ...
-
bioRxiv - Genomics 2023Quote: ... and the adaptor ligated cDNA was amplified with 12 cycles of PCR with NEBNext Primer Mix (96 Unique Dual Index UMI Adaptors RNA set1, (NEB #E7416). Equimolar amounts of the samples were then pooled and sequenced using NextSeq 500/550 70 base read lengths in paired-end mode.
-
bioRxiv - Genomics 2023Quote: The purified cDNA was PCR amplified for 6 cycles to generate dsDNA with NEBNext Ultra II Q5 High-Fidelity 2X Master Mix (NEB, M0544) and 0.5 uM PCR primers with unique dual index using the following PCR cycles:
-
bioRxiv - Molecular Biology 2023Quote: We first amplified a 77 bp long minimal TK promoter followed by the mCherry coding sequence by PCR and inserted the fragment into an NcoI-HF®-digested (NEB) pGemT-vector (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... The ADT-derived cDNAs contained in the supernatant were further purified (see SI Appendix) and used as template in a PCR reaction with the NEBNext® High Fidelity Master Mix (NEB), a Truseq small RNA RPIx (containing i7 index ...
-
bioRxiv - Genetics 2023Quote: ... was then linearized by Esp3i digestion and the HDAC4 PCR fragment was annealed downstream into the open reading frame with gibson assembly using NEB HiFi mastermix (NEB 2621L). After delivering the construct by lentivirus ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the targeted DNA region was amplified by PCR using the biomass as the template with the Q5™ High-Fidelity 2× master mix (New England Biolabs). Base-editing efficiency when targeting a plasmid-borne gene was estimated by isolating plasmid DNA upon 24-h editing treatment by using the NucleoSpin™ plasmid EasyPure kit (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2023Quote: All the plasmids were generated Gibson assembly59 by relying on gene synthesis and PCR using Q5 master mix DNA Polymerase (New England Biolabs, USA) with 40-bp homology domains ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.8 μL of this was then used to template an 8 μL PCR using LongAmp® Hot Start Taq 2X Master Mix (M0533, NEB) with each amplification containing a unique combination of forward and reverse sequencing-barcoded primers that were cherry-picked into PCR reactions using Echo 525 with a 384PP plate as was done in the construction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear DNA constructs encoding Dam or eGFP were amplified via PCR from the plasmids pJV302 (Dam) and pJV170 (eGFP) using NEB’s Q5 HotStart High-Fidelity 2x Master Mix (NEB CN# M0494S). PCR reactions were treated with 1 μL of DPNI for 3 h at 37°C and purified with Zymo Research’s Clean & Concentrator-5 kit according to the manufacturer’s protocol (Zymo CN# D4004).
-
bioRxiv - Genomics 2024Quote: ... Another round of PCR was conducted to prepare the library for sequencing using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544L), forward primer P5 and reverse primer P7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 60 containing human RNaseH1 with D210N catalytic dead mutant was amplified by PCR for cloning in pEGFP-N1 using EcoRI (NEB, #R3101S) and KpnI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Neuroscience 2024Quote: ... Successful exon excision was confirmed with single fly genomic PCR with suitable primers and Taq DNA polymerase (New England Biolabs, #M0267S) (for cycler (Biorad T100 thermo cycler ...
-
bioRxiv - Plant Biology 2024Quote: ... 260 to 300bp mRNA (CDS or UTR) sequences of enzymes were amplified by PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs) with primers listed in Supplementary Table S6and cut by BamHI and SalI (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... we performed an A-tailing of the PCR products of the YTS191-light chain cDNA by adding 5 µl of 10X ThermoPol Buffer (NEB, B9004), 10 µl of 10 mM ATP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The vector and the PCR products were then integrated using Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, #E2621S). Clones were sequenced to verify accuracy ...
-
bioRxiv - Developmental Biology 2024Quote: ... were kindly donated by Philippe Lefebvre and RARα sequences were PCR amplified with primers adding PaqCl cut sites (New England Biolabs, R0745S), cut via PaqCI and ligated into an EF1alpha-mScarlet backbone (95) ...
-
bioRxiv - Biochemistry 2024Quote: ... or ubi4-REE-act1(till the stop codon) was generated using pcr from plasmids containing these sequences using the following primers and Phusion polymerase (New England Biolabs: M0530S) (F:AATCAACGGCTTCATACCACCTCAGCCAGCCGTGT TATAACTTACCGTTTACCAACTACATTTTTTGTAACG AACCAAAAAACCCTCAAAAGACAAGACCATGCAGA TTTTCGTCAAGAC R ...
-
bioRxiv - Molecular Biology 2024Quote: ... This DNA was subjected to 18 cycles of PCR using whole genome primers (ONT #SQK-PSK004) and LongAmp Hot Start Taq 2X Master Mix (NEB #M0533). Library preparation was done using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® (NEB #E7645 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All PCR reactions were carried out in 30 μL reactions with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... The adaptor-ligated DNA on the magnetic beads was amplified by 5-8 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544) and NEBNext Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... backbone (containing Blasticidin resistance gene for the selection of transduced cells) and mCherry gene were PCR amplified using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs), remnant parent templates were digested using DpnI (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... One microliter of the LEAP reaction then was amplified in a 25 μL PCR reaction using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, M0494S) with primers specific for sequences within the SV40 promoter of the neoTet and mneoI reporter cassettes (NeoSV40_fwd ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μL of the diluted cDNA reaction was used in PCR reactions (25 μL) using the Q5 Hot Start High-Fidelity 2X Master Mix (NEB, M0494S) with NeoSV40_fwd and 3′LEAPOuter primers ...
-
bioRxiv - Genomics 2024Quote: ... DNA and cDNA from the three replicates were kept separate and underwent a 3-cycle PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544L), forward primer P7-pLSmp-ass16UMI-gfp and reverse primer P5-pLSmP-5bc-i# ...
-
bioRxiv - Plant Biology 2024Quote: ... mRNA Magnetic Isolation Module and then multiplexed via PCR amplification using NEBNext® Multiplex Oligos for Illumina® according to the manufacturer’s instructions (New England Biolabs). Library concentration was quantified with Qubit™ dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... DNA regions for plasmid assembly were identified using Biocyc (41) and amplified by touchdown PCR from the bacterial chromosomes using Q5 DNA polymerase (New England Biolabs, M0492) and oligonucleotides from Integrated DNA Technologies (Coralville ...
-
bioRxiv - Bioengineering 2024Quote: ... The transgene and sex of the F0 and F1 pups were determined by 3 PCRs of the Y chromosome using oligonucleotides described in Table S2 and LongAmp DNA polymerase (New England Biolabs, USA). Thermocycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA from clinical samples (Table S2, S3) was PCR amplified using Taq DNA polymerase with ThermoPol®-Buffer (New England Biolabs). Briefly ...
-
bioRxiv - Genomics 2024Quote: ... 50ng of LentiCRISPR v2 (addgen, #52961) and 5ng of PCR-amplified sgRNA pool was mixed with 1ul of BsmB1-V2 restriction enzyme (NEB; #R0580) and 1ul of T7 ligase (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: A Fragment Analyzer™ Automated CE System (Analysis Kit: cat.: DNF-474-0500) was used to assess the fragment distributions and a Library Quant Kit for Illumina (NEB, cat.: E7630L) was used to measure molar concentrations ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA-seq libraries were synthesized using an NEB Next Ultra RNA Library Prep Kit for Illumina and an NEB Next Adaptor for Illumina Kit (New England Biolabs, MA, USA). Paired-end sequencing was performed using the HiSeqXten (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA sequencing libraries were prepared from 100 ng of input RNA using the non-directional kit NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB, #E7775) with the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2022Quote: Site directed mutagenesis was carried out using Q5® Site-Directed Mutagenesis Kit using manufacturer’s protocol (source of kit, NEB or else) using primers carrying the altered codon were designed using the online tool OligoCalc ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were prepared according to the instructions of the Kit “NEBNext Ultra Directional RNA Library Prep kit for Illumina” (E7760L, New England Biolabs, Ipswich, MA), following the protocol “Poly(A ...
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Immunology 2023Quote: The total RNA of macrophage groups was isolated with a Nucleo-Spin RNA kit (Macharey Nagel, Germany) or Monarch Total RNA Miniprep Kit (New England Biolabs, Massachusetts, ABD). The purity and quantity of RNA were evaluated by a Nanodrop spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated using a genomic DNA extraction kit (Monarch Genomic DNA Purification Kit, New England Biolabs, Frankfurt am Main, Germany) and the PCR was optimized to yield a single amplicon ...
-
bioRxiv - Microbiology 2023Quote: ... Stranded RNA-seq libraries were constructed using NEBNext poly(A) mRNA isolation kit along with the SWIFT RNA Library Kit (NEB, MA, USA) according to the established protocols at Laboratory for Molecular Biology and Cytometry Research (LMBCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA was purified using the QIAquick PCR purification kit and it was prepared for Illumina sequencing using the NEBNext Ultra II A Library Prep Kit (New England Biolabs; Cat# E7645L).
-
bioRxiv - Systems Biology 2024Quote: ... RNAs were extracted using Qiagen RNeasyPlus Mini kit and RNA library preparation performed using NEBNext Ultra II DirecMonal RNA Library prep Kit (NEB, Lynn, MA) following the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Luna One-Step RT-qPCR Kit (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... After purified with Monarch RNA Cleanup Kit (NEB Biolabs), RNAs were polyadenylated with E ...
-
bioRxiv - Cancer Biology 2021Quote: ... After purified with Monarch RNA Cleanup Kit (NEB Biolabs), RNAs were polyadenylated with E ...
-
bioRxiv - Molecular Biology 2020Quote: ... and qPCR analysis by NEB Next Library Quant Kit for Illumina (New England Biolabs). All sequencing was performed using an Illumina MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: Libraries were prepared using Next Ultra II kits (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Using the NEBuilder HiFi DNA assembly cloning kit (NEB), EBOV VP30 was inserted into a pLenti6.3 vector (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and reverse transcribed using Lunascript kit (New England Biolabs). qPCR was performed on a Light Cycler 480 (Roche ...