Labshake search
Citations for New England Biolabs :
5951 - 6000 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Sequences for two ∼1 kb homology arms flanking the CRISPR targeting site were obtained by PCR (Q5® High-Fidelity DNA Polymerase, New England Biolabs, M0491) from parental zebrafish (AB strain ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... Microexon 4 sequence (nucleotides 1258-1281) was deleted by PCR on the pBSK-nCPEB4 plasmid using Gibson Assembly® Master Mix (New England Biolabs, E2611S), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... RUW regions were amplified from genomic DNA of transfected populations via PCR with the high fidelity Q5 polymerase (New England Biolabs, Cat. #M0491S), with an annealing temperature of 62 degrees and performing 35 cycles ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR cycles were carried out with Illumina Nextera adapter primers using the NEBNext High Fidelity 2x Master Mix (NEB, Cat# M0541S) using the following PCR program ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A PCR master mix was employed with final concentrations of Standard ThermoPol buffer Mg-free (1x) (New England Biolabs, Ipswich MA, USA), dNTPs (0.2 mM each ...
-
bioRxiv - Biochemistry 2023Quote: ... was PCR amplified from pDONR221-SUMO2 plasmid (purchased from DNASU plasmid repository, United States) using Phusion® High-Fidelity DNA Polymerase (NEB, USA) with forward primer 5’ GATGGATCCATGGCCGACGAAAAG 3’ and reverse primer 5’ TTCAAGCTTTTAACCTCCCGTCTGCTG 3’ as per the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... was fused to the cDNA sequence of mScarlet-I by PCR and subcloned into pMNATZA1 using Gibson assembly with NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA). The spPKA-KTR1.0 is stably expressed under the Padh1 promoter from the Z locus ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids were constructed by assembling DNA fragments amplified by PCR into restriction endonuclease-digested vectors using NEB Hifi Builder (NewEngland BioLabs; cat.no: E2621L). The plasmids were confirmed with restriction digestion and sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... appropriate number of amplification cycles x (98C - 10sec, 63C – 30sec, 72C – 1 min) with NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) and barcoded Nextera primers (1.25 μM each ...
-
bioRxiv - Immunology 2023Quote: ... The multiplex products were used as templates to the second PCR using Phusion High-Fidelity DNA Polymerase (New England Biolabs Inc., M0530L) that barcodes each well/perturbation separately ...
-
bioRxiv - Synthetic Biology 2023Quote: BigBlocks were PCR-amplified with dedicated primer pairs in a 25.0 μL PCR reaction mix composed of 0.25 μL Q5® Hot Start High-Fidelity DNA Polymerase 2 U/μL (NEB® M0493), 5.0 μL Q5® 5X buffer (NEB® B9027) ...
-
bioRxiv - Microbiology 2023Quote: ... purified and subjected to ligation with the digested and gel-purified PCR product utilizing T4 DNA ligase (New England Biolabs, Cat. # M0202S).
-
bioRxiv - Cell Biology 2023Quote: ... Hbx insert was PCR amplified from pcDNA3-HBV(Gao et al., 2004) with Phusion DNA polymerase (New England Biolabs Cat. No. M0530S) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We size-selected these libraries using a Pippin Prep (Sage Science, Beverly MA) and then amplified and indexed them via PCR (Phusion, New England Biolabs, Ipswich MA). At each stage ...
-
bioRxiv - Microbiology 2023Quote: ... the Strep-tag® II sequence was inserted at the C-terminus via Phusion® High-Fidelity DNA Polymerase mutagenesis PCR (New England Biolabs) using the primers pYS14_GA_F/ 5’ phosphorylated flaakstrp14R to amplify the whole plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the integrated sgRNA sequences were amplified and barcoded by two-step PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, cat # M5044). The barcoded sgRNA samples were sequenced on an Illumina NextSeq500 to quantitate representation of each sgRNA in the Ub/Ubl pathway inhibitor-treated or non-treated control samples ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantitative PCR was run on the Eppendorf Mastercycler (SybrGreen) using the LUNA Universal qPCR Master Mix (New England Biolabs, Catalog # M3003). Primers used for real-time qPCR can be found in Supplementary Data 5.
-
bioRxiv - Biochemistry 2023Quote: ... and then the two PCR products were co-transformed into yeast along with pCB05 digested with BstXI (New England Biolabs [NEB], Catalog # R0113S) and XhoI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... and 28.7 uL of water were combined to form a 50 uL reaction (Phusion PCR reagents were purchased from New England Biolabs, Ipswich, MA). The thermocycling protocol proceeded first with an incubation at 98°C for 30 seconds ...
-
bioRxiv - Biophysics 2023Quote: ... CBD binding site mutants were generated using the two-step PCR method using Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich MA), T4 ligase Quick Ligation kit (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2023Quote: We designed amplification primers for the extracted assembly sequences using Geneious Prime (Biomatters Ltd) and generated PCR amplicons using Q5 High-Fidelity 2X Master Mix (New England Biolabs catalog # M0492), Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs catalog # M0531) ...
-
bioRxiv - Plant Biology 2022Quote: ... employing triple template PCR as described128 with primer sequences listed in Supplementary Table S1 using the Q5 polymerase (New England Biolabs, Ipswich, USA). The knockout constructs were released from their vector backbones with XhoI (PpAARE1) ...
-
bioRxiv - Biochemistry 2023Quote: ... The genes were amplified by PCR and cloned into pET28a(+) using T4 DNA ligase (New England Biolabs GmbH, Frankfurt am Main, Germany) or In-Fusion Cloning (Takara Bio Europe ...
-
bioRxiv - Microbiology 2023Quote: ... was completed by ligating PCR-amplified 750bp fragments flanking the gene of interest into the suicide vector (pExchange-tdk) using Sal1 (NEB, Cat. # R0138L) and Xbal (NEB ...
-
bioRxiv - Systems Biology 2023Quote: ... 60 bp primer + 44 bp adapter sequences) were amplified via PCR and adapter sequences were removed using restriction enzymes BciVI (New England BioLabs GmbH, R0596S) and BspQI (New England BioLabs GmbH ...
-
bioRxiv - Genomics 2023Quote: ... catalog #FC-131-2001 and #FC-131-2004) using ≈15 ng of first-round PCR product as template and NEBNext Polymerase (New England Biolabs, catalog #M0541S). Final libraries were quantified via Qubit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were selected for cDNA target fragments of 200 bp on 2% low-range Ultra agarose followed by PCR amplification using Phusion DNA polymerase (NEB, United States) for 15 PCR cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... Digested backbone and PCR amplified fragments were joined via seamless cloning (NEBuilder® HiFi DNA Assembly Master Mix, NEB, Cat. No. E2621S). Assembled plasmid was Sanger-sequenced to ensure correct assembly and reading frame ...
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Bioengineering 2023Quote: ... from the AAV genomes following the fourth round of selection by PCR using Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) and 21 cycles of PCR ...
-
bioRxiv - Immunology 2023Quote: ... Read 1 and Read 2 sequencing primers (sequences listed in Table S2) were added PCR fragments by T/A ligation using NEBNext Ultra II Ligation Module (E7595, New England Biolabs, Ipswich, MA). Spacers and minimal promoter were added to sequencing primer-ligated enhancers using the primers 5BC-AG-f02 and 5BC-AG-r02 (Table S2) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting fragment was subjected to error-prone PCR under the following conditions: 5 U of Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Microbiology 2023Quote: ... 9 DNA fragments encoding the partial genome of SARS-CoV-2 were prepared by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Cat# M0491S). A linker fragment encoding hepatitis delta virus ribozyme ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR fragments and the vector backbone were assembled following the Gibson Assembly manufacturer’s protocol (#E2611, New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... 600 bp DNA sequences flanking the open reading frames of rmlC (PA5164) were PCR amplified using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) (38) ...
-
bioRxiv - Genomics 2023Quote: ... 1 μL of the resulting cDNA was then subjected to PCR amplification using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0491L) and primers specific to the reporter mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified for 9 cycles for the hepatocyte libraries and 8 cycles for the liver organoid libraries using Phusion® High-Fidelity PCR Master Mix (NEB, M0531S) with the Nextflex primers ...
-
bioRxiv - Cancer Biology 2023Quote: sgRNA were directly amplified from genomic DNA in one step PCR using NEBNext® Ultra™ II Q5® Master Mix (NEB). Each PCR reaction was done with 10µg of genomic DNA in 100µL final volume ...
-
bioRxiv - Neuroscience 2023Quote: ... Up to 10 ng of gDNA was amplified in a 20 μl volume using NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, #M0541S) supplemented with 5% dimethyl sulfoxide and barcoded primers specific to HTT Exon 1 (0.5 μM each) ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA2 and sgRNA3 from the 4sgRNA library were amplified (595 bp) by PCR using NEB Q5 DNA polymerase (NEB, Ipswitch MA, USA) with a universal P7 primer and individual P5 primer ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted and the sgRNA (HMBS) target locus was PCR amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, Massachusetts) (forward primer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All polymerase chain reactions (PCR) used for routine cloning were conducted using Q5 High Fidelity DNA polymerase 2X Master Mix (New England BioLabs, Ipswich, MA). Plasmids were constructed using isothermal DNA assembly with 40-60 bp overhangs (NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Genetics 2023Quote: ... PCR was then performed in a mix of 10 µM Nextera i7 and i5 primers and NEBNext Q5 High-Fidelity PCR Master Mix (New England Biolabs, MA, USA) according to the following protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... DNA templates were generated from the pET28c-F30-Broccoli template plasmid using PCR and utilizing the Phusion® high-fidelity DNA polymerase (NEB, UK), forward primer 5’-ATA CCC ACG CCG AAA CAA- 3’ and reverse primer 5’-MGMGG AGC CCA CAC TCT ACT-3’ (where MG represents 2’-O- methoxyethyl (MOE)-modified guanine) ...
-
bioRxiv - Neuroscience 2024Quote: ... Sequence encoding the modified capsid insertion was amplified using serotype-specific primers with PCR cycles less than 30 by using Q5 2x Master Mix (NEB, Ipswich, MA). Two microliters of 1st round of PCR products were input to total 50 µl reaction of second round PCR to introduce Illumina i5 and i7 sequencing indices ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The amplicons were purified and subjected to error-prone PCR under the following conditions: 5 U Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Microbiology 2024Quote: ... single colonies were picked and used as a template for amplification by PCR using Q5 DNA polymerase (New England Biolabs, Whitby, Canada) with primers CR1_F and R as well as CR3_F and R (Supplementary Table 2 ...