Labshake search
Citations for Illumina :
401 - 450 of 1318 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Microbiology 2019Quote: ... RNA from cultures grown on PM-4-HBA and PM-syringic acid was processed and sequenced at the University of Wisconsin-Madison Biotechnology Center (Illumina HiSeq2500, 1×100 bp, single end). RNA from cultures grown on PM-succinate was processed and sequenced at the U.S ...
-
bioRxiv - Microbiology 2022Quote: The 16S and ITS libraries were prepared by the sequencing facility using the Illumina TruSeq≡Nano DNA Library Prep Kit (Illumina, Inc., San Diego, CA, United States), llumina MiSeq was run using a v2 Standard sequencing format with paired end reads (2 x 250 bp) ...
-
bioRxiv - Microbiology 2023Quote: ... the purified PCR product was used to prepare 16S rRNA gene libraries which were then sequenced on an Illumina MiSeq instrument (Illumina Inc., San Diego, CA, United States) using the MiSeq reagent kit v3 (2 × 300 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 µL of Enhanced PCR Mix (supplied with an Illumina DNA Prep kit), and 27.5 µL of water ...
-
bioRxiv - Neuroscience 2021Quote: ... and cell pellet gently resuspended in 20 μ ltagment DNA buffer (Nextera, Illumina), 1 μtagment DNA enzyme (Nextera ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 tumor-normal pairs were sequenced using the Truseq DNA kit (40Mb; (Illumina)) on the NovaSeq (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in 20 µL reactions with 4µL Nextera Unique Dual Indexes Set A (Illumina). We then quantified libraries by Qubit (ThermoFisher ...
-
bioRxiv - Genomics 2023Quote: ... Following sequencing to at least 20 million reads on a NovaSeq platform (Illumina), reads were processed following the ENCODE pipeline (https://github.com/ENCODE-DCC/rna-seq-pipeline) ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pooled products with 10-20% PhiX were sequenced on HiSeq 2500 system (Illumina).
-
bioRxiv - Genomics 2020Quote: ... and then sequenced 20-40M pair-ended reads using Illumina’s HiSeq platform 2500 (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... genomic DNA (gDNA) was diluted to 20 ng/μL using Resuspension Buffer (RSB, Illumina) and 55 μL were transferred to Covaris microTubes (Covaris ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pooled libraries were loaded at 1.1M with 20% standard PhiX library (Illumina, CA, USA) and sequenced to 75 base pair single end on a NextSeq 500 (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nuclei were re-suspended in 20 μl of Tn5 transposase reaction buffer (Illumina). After tagmentation ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2019Quote: ... 4 ng ChIP DNA was incubated with transposase (Illumina, Fc-121-1030) for 10’ at 55’C ...
-
bioRxiv - Genomics 2021Quote: ... 3nM libraries were loaded across 4 lanes on the HiSeq 4000 (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 4 out of 49 samples only had microarray genotype data from Illumina Omni2.5 chips ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The final library was diluted to 4 nM using Resuspension Buffer (Illumina). The rest of the library preparation was completed following the Denature and Dilute Libraries Guide for MiniSeq System by Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Genetics 2020Quote: ... and 0.1% Tween-20) and tagmentation was carried out using 2.5ul Tn5 transposase (Illumina 15027865) for 30 mins ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 20 μg of total RNA were used in high-throughput cDNA sequencing by Illumina HiSeq 2000 technology (Fasteris SA ...
-
bioRxiv - Genomics 2021Quote: ... and 0.1% Tween-20) and tagmentation was carried out using 2.5ul Tn5 transposase (Illumina 15027865) for exactly 30 mins ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... mixed with Pfix (20%) and then loaded on NextSeq 500 sequencher (Illumina, San Diego, CA). Sequencing was performed in PE (pair-end ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).