Labshake search
Citations for Illumina :
201 - 250 of 1318 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Custom sequencing libraries were prepared as previously described (16) and sequencing was performed using a NextSeq system (Illumina). To filter for significantly enriched peptides ...
-
bioRxiv - Microbiology 2019Quote: The V3-V4 regions of the 16S rRNA were sequenced at IBBL using an Illumina Platform (Illumina MiSeq) using 2×300bp paired-end reads (Hipp et al ...
-
bioRxiv - Genetics 2020Quote: ... 16-30-nt RNAs were size selected on 17% denaturing polyacrylamide gels and treated with RNA polyphosphatase (Illumina) to reduce 5′ di- and triphosphates to monophosphates to enable 5′ adapter ligation ...
-
bioRxiv - Microbiology 2021Quote: ... The 16S rRNA gene amplicon sequencing was performed on an Illumina MiSeq platform (Illumina, San Diego, CA, USA) according to the standard protocols by Majorbio Bio-Pharm Technology Co ...
-
bioRxiv - Microbiology 2020Quote: ... the V4 region of the 16S rRNA gene was amplified following the EMP protocol (http://www.earthmicrobiome.org/protocols-and-standards/16s/) and sequences were obtained by Illumina MiSeq at the Argonne Sequencing Center (Lemont ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene was amplified by PCR (341F_primer: CCTACGGGNGGCWGCAG, 806R_primer: GACTACHVGGGTATCTAATCC) and sequenced on the MiSeq platform (Illumina) using 2 × 300 base pair paired-end protocol ...
-
bioRxiv - Microbiology 2023Quote: ... which were further processed using the 16S Metagenomic Sequencing Library Preparation Protocol (Part No. 15044223 Rev. B – Illumina). Amplifications were carried out using a Verity Thermocycler (Applied Biosystem ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene amplicons were sequenced using the 2 x 300 bp paired-end MiSeq protocol (Illumina).
-
bioRxiv - Microbiology 2023Quote: We performed amplicon sequencing of the 16S rRNA V3-V4 region on the MiSeq platform (Illumina, CA, USA) using the primer combination 341F (5’-CCTACGGGNBGCASCAG-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: The V3-V4 16S rRNA gene amplicon sequencing library was sequenced on a MiSeq benchtop platform (Illumina, USA) and datasets of 250 bp paired-end reads were generated ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic profiling was performed on 16 DMG neurospheres using an Illumina TruSight Oncology 500 (TSO500, Illumina, CA, USA) next-generation sequencing (NGS ...
-
bioRxiv - Microbiology 2022Quote: Sequencing libraries were generated from the 16 middle fractions of each sample using Nextera XT v2 chemistry (Illumina) with 12 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: ... amplification and PCR products index labeling adapted from the bacterial 16s rRNA Metagenomic sequencing library preparation (Illumina, USA). The previously designed primers were modified for NGS analysis adding the following overhang adaptors to the 5’-prime end of each forward and reverse primers ...
-
bioRxiv - Microbiology 2019Quote: ... HTM primer (with Illumina adapter, 20 μM) – 1 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20% of the amount recommended by Illumina was used (adapters were diluted 1:10 in RSB) ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Immunology 2024Quote: ... TRB sequencing was performed on pools of libraries from 11 - 15 tumor or skin samples on the Illumina MiSeq platform using a v3 150-cycle kit (Illumina, San Diego, CA) in the FHCC Genomics Core Facility (Seattle ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 120 μl pooled 20 pM library and 15 μl denatured 20 pM PhiX control library (Illumina, FC-110-3001) after a 2 minute heat treatment at 96 °C followed by a 5 min incubation on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2020Quote: ... sequencing reads were mapped to reference viral genome sequence and consensus sequence for each sample was built using Dragen RNA pathogen detection software (version 9) in BaseSpace (Illumina Inc, USA). For amplified whole-genome sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNAs from WT and e2fabc at 9 DAG were used for construction of cDNA libraries using the TruSeq RNA Library Preparation Kit v2 (Illumina, United States) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... These 16S rRNA gene libraries were then sequenced on an Illumina MiSeq instrument (Illumina Inc., San Diego, CA, USA) using the MiSeq reagent kit v3 (2 × 300 bp ...
-
bioRxiv - Microbiology 2020Quote: ... The library preparations were carried out according to 16S library preparation protocol of Illumina (Illumina, San Diego, CA, USA). Libraries were sequenced using the MiSeq Reagent Kit v2 (500 Cycles) ...
-
bioRxiv - Microbiology 2022Quote: ... The second round of PCR followed the manufacturer’s guidelines for 16S rRNA Metagenomic Sequencing Library protocol (Illumina, Cat.: 150442223) for the MiSeq system ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were sent to Novogene (USA/China) for paired-end 16S sequencing on a NovaSeq 6000 platform (Illumina, USA) and analysis (Data not shown) ...
-
bioRxiv - Microbiology 2019Quote: ... the three samples were also subjected to 16S rRNA gene amplicon sequencing on a MiSeq benchtop sequencer (Illumina Inc.). DNA was extracted from separate aliquots of the same sediment samples using the DNeasy PowerLyzer PowerSoil kit (MO BIO Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... The microbiota amplicon sequencing was performed following the protocol of the 16S Metagenomics Sequencing Library Preparation recommended by Illumina. The V3 and V4 region from 16S rRNA gene were amplified by PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These dsDNA pools were processed as described in the 16S Metagenomic Sequencing Library preparation protocol (Illumina, USA) (Illumina 2013). In summary ...
-
bioRxiv - Microbiology 2023Quote: 16S-EZ ribosomal RNA (rRNA) library preparations and sequencing on an Illumina MiSeq instrument (Illumina, San Diego, CA, USA) were conducted at GENEWIZ ...
-
bioRxiv - Microbiology 2023Quote: Sequencing of the 16S rRNA gene V4 amplicons was performed on the Illumina MiSeq platform (Illumina Inc, Cambridge, UK). Raw sequence data were imported into the quantitative insights into microbial ecology (QIIME ...
-
bioRxiv - Genomics 2020Quote: ... and 8 to 11 kb were generated using the gel selection-based protocol of the Nextera mate pair kit (Illumina, San Diego, CA, USA) and a 0.6% agarose gel in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: 20-50ng PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) total 20µl ...
-
bioRxiv - Biophysics 2021Quote: ... with 20% PhiX (Illumina cat#FC-110-3001) spike-in yielding 903,488 reads.
-
bioRxiv - Molecular Biology 2019Quote: ... including 20% of PhiX Control v3 DNA (Illumina). Data was analyzed using CLC Genomics Workbench 8 and Microsoft Excel.
-
bioRxiv - Immunology 2021Quote: ... Denatured libraries were diluted with 20% PhiX (Illumina) as an internal quality control and loaded onto a 600-cycle V3 MiSEQ cartridge (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... The capture libraries were sequenced on MiSeq (9 samples per run) or HiSeq (96 samples per run) NGS platforms (Illumina, San Diego, CA) as previously described24 ...
-
bioRxiv - Neuroscience 2021Quote: ... with 5 ng input RNA followed by 9 cycles of PCR amplification and library preparation using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA). Sequencing was performed on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded total library preparation kit with RiboZero Gold treatment (Illumina, Inc., Cat No.20020598/9). Paired-reads (150 bp ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples with an RNA integrity number of > 9 were used for construction of a complementary DNA library by an Illumina TruSeq kit (Illumina, San Diego, CA). The sequencing strategy was 100 bp paired-end by an Illumina HiSeq 4000 ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...