Labshake search
Citations for Illumina :
651 - 700 of 1318 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3) DNA Sequencing and Genomics Laboratory (BIDGEN): Libraries were prepared using the Nextera™ DNA Flex Library Preparation Kit (Illumina) and sequenced on a NovaSeq6000 to generate 2 x 150 bp reads ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA libraries were prepared using QuantSeq 3’-mRNA Library Prep Kit (Lexogen) and RNA-seq was performed with the NovaSeq 6000 (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lexogen) and samples were sequenced on the HiSeq4000 (Illumina) in single read mode at the Genomics Core (KU Leuven) ...
-
bioRxiv - Pathology 2024Quote: ... The cDNA libraries were prepared using a Chromium Single Cell 3’ V3 kit (10X Genomics, USA) according to the manufacturer’s instructions and then sequenced on a NovaSeq6000 (Illumina, USA). Raw sequencing reads were aligned to the mm10 (GENCODE vM23/Ensembl 98 ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 µl of sample were used to generate single cell RNA-Seq libraries by following the Illumina Bio-Rad SureCell WTA 3’ Library Prep Guide (Illumina, San Diego CA and Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Genetics 2021Quote: ... The permeabilized myonuclei were tagmented with tagmentation mixture optimized for use on a myofiber (20 µL Tagment DNA Buffer (TD Buffer) (Illumina, 20034197), 13.3 µL PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sample libraries (20 nM) were subjected to multiplex next generation sequencing using an Illumina HiSeq4000 (Illumina Inc.; San Diego, CA, USA). Quality control on raw reads was performed using FASTQC ...
-
bioRxiv - Microbiology 2019Quote: ... containing 20% phiX DNA was denatured and sequenced (2 × 250 nt) on an Illumina MiSeq instrument (Illumina Inc, San Diego, CA) using a v2 500 cycle kit ...
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... libraries were pooled using a final concentration of 20 pM and subjected to paired-end sequencing using Illumina HiSeq 2500 (Illumina, USA) platform and HiSeq Paired-End Cluster Kits v4.
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Biochemistry 2024Quote: ... a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina adapters). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... We sequenced pooled final libraries targeting 20 million reads per sample on the NovaSeq 6000 S4 flowcell (Illumina, San Diego, CA).
-
bioRxiv - Biochemistry 2024Quote: As template a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina primers). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before being diluted to approximately 4 nM for loading onto an Illumina MiSeq (Illumina, San Diego, CA, USA). An Illumina 500 cycle MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and 4 samples were combined into RNA-seq runs on the Illumina MiSeq platform (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... The final libraries at the concentration of 4 nM were sequenced on NextSeq 500 platform (Illumina, CA, USA) using 75 bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reads were trimmed to remove adapter sequences and low-quality regions (Q < 30 and Q < 20 for Illumina and 454 data, respectively) were removed using Cutadapt 1.4.1 (Martin 2011 ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 ul H2O) at 37◻°C for 30◻min (TruePrep® DNA Library Prep Kit V2 for Illumina, Vazyme, China). After the tagmentation ...
-
bioRxiv - Immunology 2020Quote: ... then sequenced to a depth of at least 20 M single-end 75 bp reads using NextSeq 500 (Illumina, San Diego, CA).