Labshake search
Citations for Illumina :
501 - 550 of 1318 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified m6A-seq libraries were sequenced on an Illumina MiSeq platform with 10-20% PhiX control library (Illumina). The data is deposited in the Gene Expression Omnibus (GEO ...
-
bioRxiv - Microbiology 2022Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit).
-
bioRxiv - Synthetic Biology 2022Quote: ... normalized to 20 ng/μL and sent to Genewiz for Amplicon-EZ sequencing service (Illumina HiSeq 2×150). This service typically returns 40,000 sequences however in some cases fewer than 40,000 sequences were returned ...
-
bioRxiv - Systems Biology 2022Quote: ... were lysed and transposed simultaneously in 25 µl of transposition mix (0.1% NP40, 0.1% Tween-20, 0.01% digitonin and 5% Tn5 enzyme (Illumina # 15027865) in Tagment DNA Buffer (FC-121–1030 ...
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Genetics 2024Quote: ... Small RNA libraries were prepared from ∼20–45 nt total RNAs using Small RNA Library Preparation kit (Illumina) and analyzed by Illumina HiSeq 2500 platform.
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Cancer Biology 2019Quote: 3’ RNA-seq library was prepared using a standardised protocol followed by sequencing using a HiSeq4000 platform (Illumina) at the Oxford Genomics Centre (Wellcome Trust Centre for Human Genetics ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR products were gel purified in 3% agarose gel and qPCRed (using NEBNext Library Quant Kit for Illumina) to quantify concentration ...
-
bioRxiv - Genomics 2021Quote: ... Single-cell libraries were prepared using the SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina). The quality of the libraries was assessed using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene expression and barcode libraries were prepared in parallel using the Chromium Next GEM Single Cell 3’ Kit v3.1 (10x Genomics) according to manufacturer’s instructions and sequenced in a Novaseq 6000 system (Illumina). A detailed step-by-step protocol can be found on protocols.io ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the QuantSeq 3′mRNA-Seq Library Prep Kit-FWD by Illumina (Lexogen, Vienna, Austria), using 500 ng of total RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg of total RNA samples underwent treatment with the epicenter Ribo-ZeroTM Kit (Illumina, San Diego, USA) to remove rRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... These cells were processed through the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10X Genomics) according to manufacturer’s recommendations and sequenced on Novaseq6000 (Illumina). The data were processed through the CellBender software to decrease contamination by ambient RNA (Fleming et al. ...
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and 4 nM of each library pooled using unique indices before sequencing on a MiSeq (Illumina) and paired 300-bp reads.
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Immunology 2019Quote: ... Hybridization of the cRNA was performed on an Illumina Human-HT12 Version 4 chip set (Illumina). Microrarray data were exported from GenomeStudio (Illumina ...
-
DJ-1 (Park7) affects the gut microbiome, metabolites and development of Innate Lymphoid cells (ILCs)bioRxiv - Immunology 2019Quote: ... and 4 nM of each library pooled using unique indices before sequencing on a MiSeq (Illumina) and paired 300-bp reads.
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pH8.5) with 0.1% Tween 20 and sequenced with 100bp single end reads on Novaseq 6000 (Illumina, Inc., California, USA) according to standard protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina, USA) using MiSeq reagent v3 kit to generate 300 bp paired-end reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... Supernatant was discarded and pellets resuspended in 20 μl ATAC reaction buffer containing 10 μl 2x transposase buffer and 2.5 μl Tn5 enzyme (Illumina). Samples were incubated at 37 °C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... sex and 20 genetic principal components (derived from multidimensional scaling of genotype data from the Illumina 610-Quadv1 array).
-
bioRxiv - Genomics 2021Quote: ... The cell pellets were then resuspended in 20 μl, 10 μl, and 8 μl of transposition mix (25 μl 2×TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2022) sequenced 20 vaquita porpoise (Phocoena sinus) whole genomes from the Gulf of California to 60x coverage (Illumina HiSeqX). They mapped reads to the vaquita reference genome (mPhoSin1.pri ...
-
bioRxiv - Neuroscience 2023Quote: ... A bead ratio of 0.9x was used (20 ul of Sera-Mag Select beads to 22.10 ul library product, as per Illumina protocol), and all samples were eluted in 22 μl of Resuspension Buffer (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 200uL of Transposition Mix (1x TD buffer containing 20 U/mL Superase-In RNase Inhibitor, 40 U/mL RNasin ribonuclease inhibitor and 1.25 µl of Illumina Tagment DNA TDE1 Enzyme per every 100 000 nuclei ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pellets were resuspended in 50 µL of transposition reaction (2X TD buffer, 1X PBS, 0.1% Tween-20, 0.1% Digitonin, 5µL of Illumina Tn5 transposase) and incubated for 30 min at 37°C with 1,000 rpm agitation ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NextSeq 500 instrument (Illumina) or NovaSeq instrument (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were prepared using the Chromium Single Cell 3’ v2 kit and sequenced on a HiSeq system (Illumina) at Institut Curie NGS facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries that passed QC (>3 ng/μL) were sequenced using an Illumina HiSeq sequencer (Illumina, San Diego, CA, USA) with the paired-end 150-bp sequencing model based on >5G raw data output per sample.
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2021Quote: 3′-scRNAseq was completed using Chromium Next GEM single cell 3′ GEM library and Gel bead Kit v3.1 (10x Genomics) and sequenced using a NextSeq 500 (Illumina) at Genomics Birmingham (University of Birmingham) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Genomics 2019Quote: ... Genotyping was carried out using the Infinium II HumanHap 550K Genotyping BeadChip version 3 (Illumina, San Diego, California USA). Collection and purification of DNA have been described previously (Kayser et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA sequencing was performed on an Illumina MiSeq at RBGK with version 3 chemistry (Illumina, San Diego, CA, USA) and ran for 600 cycles to generate 2 × 300 bp paired-end reads ...
-
bioRxiv - Pathology 2021Quote: ... Single cell transcriptome libraries of liver cells were prepared with Chromium Single Cell 3’ NextGEM Reagent Kit v3.1 (10X Genomics) to performed sequencing on NextSeq 550 (Illumina) and demultiplexing pipeline with CellRanger v5.0.0 (10x Genomics) ...