Labshake search
Citations for Illumina :
551 - 600 of 1318 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The library was spiked with 10% of 12.5 pM PhiX and sequenced using 150 cycles of MiSeq version 3 chemistry (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The snRNA-seq library were constructed with 10x Genomic protocol (Chromium Single Cell 3’ Reagent Kits v3.1User Guide) and sequenced by Illumina NovaSeq.
-
bioRxiv - Immunology 2023Quote: ... using the Chromium Single Cell Gene Expression Solution 3’ v2 (10x Genomics) and sequenced by the DNA Sequencing Facility (RRID: SCR_017759) using NovaSeq6000 (Illumina) with read lengths of 29-bp + 90-bp (Read1 + Read2) ...
-
bioRxiv - Microbiology 2023Quote: Metagenomic shotgun sequencing was performed at the Norwegian Sequencing Centre on two lanes of the HiSeq 3/4000 (Illumina) generating 150 bp paired-end reads in both lanes ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... was constructed using the QuantSeq 3’ mRNA-seq FWD kit (Lexogen) and the UMI Second Strand Synthesis Module (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single-cell libraries were generated using 10X Genomics Chromium Single-cell 3’ Library RNA-Seq Assays protocols targeting 8,000 cells from each fraction were sequenced on the NovaSeq sequencer (Illumina). The scRNA-seq data were analyzed with the Partek Flow software (Partek Inc) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were pooled and sequenced with 75bp single-end sequencing to a depth of 20 × 106 reads per sample on a NextSeq500 (Illumina). Raw sequencing reads were demultiplexed using bcl2fastq (v2.17.1.14 ...
-
Phenotypic and molecular evolution across 10,000 generations in laboratory budding yeast populationsbioRxiv - Evolutionary Biology 2020Quote: ... Libraries were sequenced to an average depth of 20-fold (haploids) or 40-fold (diploids) coverage using a Nextseq 500 (Illumina).
-
bioRxiv - Synthetic Biology 2019Quote: ... and a 10%-20% PhiX was spiked in as a control (PhiX is a genomic DNA sample provided by Illumina).
-
bioRxiv - Genetics 2019Quote: Raw reads were preprocessed with cutadapt v1.15 26 to trim potential low quality bases (-q 20 -m 25) and potentially remaining sequencing adapters (-a and -A option with Illumina TruSeq adapter sequences according to the cutadapt documentation ...
-
bioRxiv - Cancer Biology 2022Quote: ... The nucleic were further resuspended in transposition mix (2X TD buffer, 1X PBS, Digitonin 0.01%, tween 20 0.1%, NFW 5ul, and Illumina transposase 2.5ul). Mixing ...
-
bioRxiv - Bioengineering 2022Quote: ... libraries were pooled at a ratio of 80% cellular RNA to 20% oligonucleotide barcoded antibodies and sequenced with NextSeq 1000/2000 kit (Illumina) using the following read length ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Microbiology 2020Quote: ... the sequencing protocol developed by Persson and co-workers (6,14) was adapted to the deep amplicon sequencing protocol provided by Illumina (20). The modified primers are shown in Table 1 ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced to obtain more than 20 million 100 × 100 bp paired-end reads (S4 P200 flow cell and sequencing Kit; Illumina) mapping uniquely to mouse mm10 mRNA reference.
-
bioRxiv - Genomics 2021Quote: ... The final libraries were then pooled together (15-20 at a time) and sequenced using the NextSeq 500/550 kit High Output Kit v2.5 (Illumina 20024906). The Illumina output files were converted to fastq format using bcl2fastq (v2.20.0.422 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation of genomic DNA was done using the LITE pipeline as described previously (20) and sequencing was performed using Nextseq (Illumina) with a Mid Output Flowcell (NSQ® 500 Mid Output KT v2) ...
-
bioRxiv - Genetics 2022Quote: ... PCR products from each locus were pooled to equimolarity at 20 ng/µl and submitted to GeneWiz (Azenta Life Sciences) for sequencing (Amplicon-EZ: Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were sequenced to a depth of 20 million paired-end 2×150bp reads each on the NovaSeq 6000 (Illumina) at University of Colorado Genomics and Microarray Core.
-
bioRxiv - Cell Biology 2022Quote: Sequencing libraries were prepared by polyA selection for mRNA and sequenced to a depth of 20-30 Mio reads (HiSeq 4000 2 × 150 paired-end configuration, Illumina). Sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36 ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei pelleted in ATAC-wash-resuspension buffer and resuspended in transposition mix (2X TD buffer, 1X PBS, Digitonin 0.01%, tween 20 0.1%, NFW 5ul, and Illumina transposase 2.5ul). Libraries were PCR-amplified using the NEBNext Hi-Fidelity PCR Master Mix and Integrated DNA Technologies (IDT ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... Paired-end (150-bp) sequencing of each library (approx. 20 million reads per library) was then performed on the NextSeq 550 platform (Illumina). All library preparation and sequencing procedures were carried out by the Analytical Facility at QIMRB.
-
bioRxiv - Systems Biology 2023Quote: ... the final library was diluted to 20 nM with HT1 buffer and PhiX control v3 (20%, v/v) and 600 µL was loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina). The resulting sequences were uploaded to Illumina Sequence Hub and downloaded using BaseSpace Sequence Hub Downloader (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: Eluted PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... The library was sequenced on 4 lanes of an Illumina HiSeq 1500 (Illumina Inc.; San Diego, CA), generating 450,132,548 reads which were subsequently trimmed to remove adapters and filtered for length and quality using FASTX-Toolkit v0.0.14 (available from http://hannonlab.cshl.edu/fastx_toolkit/) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Pools of 4 or 5 multiplexed libraries were loaded per lane of a HiSeq 2000 sequencer (Illumina) at 8 pM and single-end sequenced using the 100 bp protocol.
-
bioRxiv - Genomics 2019Quote: ... After normalization the libraries were sequenced in 4-plex on HiSeq 2000 or HiSeq 2500 machines (Illumina) in paired-end 2 × 100 bp.
-
bioRxiv - Developmental Biology 2019Quote: The paired-end reads for each sample run across 4 lanes of the flow cell (20022408, Illumina) were concatenated to obtain one forward and one reverse fastq.gz files each ...
-
bioRxiv - Molecular Biology 2019Quote: ... (4) The amplified fragments were sequenced on the Illumina HiSeq™ 4000 platform (Illumina, San Diego, USA) by Gene Denovo Biotechnology Co ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 Sequencing System (Illumina, California, USA) using NextSeq 500/550 High Output Kit v2 (150 cycles ...
-
bioRxiv - Genomics 2021Quote: ... The library pool was sequenced on all 4 lanes of an NovaSeq 6000 S4 flow cell (Illumina) for 150 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... We observed less than 4% barcode swapping between the two barcodes (more than 96% of the Illumina sequencing reads contained correct endodomain and barcode pairs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were prepared using a Chromium Single Cell 3’ Library & Gel Bead kit v2 (10x Genomics, PN-120237) and sequenced using a NextSeq 500 (Illumina). The mean number of reads per cell was approximately 25,000 and the median number of genes detected per cell was approximately 2,000.
-
bioRxiv - Cell Biology 2020Quote: ... Indexed sequencing libraries were constructed using the Chromium Single-Cell 3’ library kit (10X Genomics) and sequenced on NovaSeq 6000 (Illumina) with the following parameters ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNAs samples (3 μg) were depleted from ribosomal RNA using the bacteria Ribo-Zero® rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single cell library preparation was performed using a Chromium Single Cell 3’ Reagent Kit v3 (10X Genomics) and sequenced by Illumina HiSeq ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was harvested and diluted to 0.1–0.3 ng/μl and libraries were prepared in 96-well plates using a Nextera XT DNA Sample Preparation kit (Illumina) according to the protocol supplied by Fluidigm ...
-
bioRxiv - Neuroscience 2020Quote: Tagmentation was performed per pool by adding 3 μL double-stranded cDNA sample to 5.5 μL Nextera TD buffer (Illumina, 15027866), 2.5 μL NF H2O and 1.0 μL TDE1 Enzyme (Illumina ...
-
bioRxiv - Systems Biology 2020Quote: ... 8 pools of 24 randomized libraries were sequenced in 3 lanes at 100 bp single-end on the HiSeq 2500 (Illumina) using TruSeq SBS Kit v4 reagents (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... The cDNA was then fragmented and amplified for 3’ prime end sequencing with the Nextera XT DNA sample prep kit (Illumina). The libraries were purified ...