Labshake search
Citations for Illumina :
8101 - 8150 of 8781 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Bacterial 16S V3-V4 regions were amplified by PCR using universal primers derived from DBact-0341-b-S-17 and S-D-Bact-0785-a-A-21 (24) containing unique adapters for the Nextera XT indexing kit according to the manufacturer’s instructions (Illumina Inc., San Diego, CA). Fungal ITS2 regions were amplified using separate unique adapter primers derived from IST3_KYO1 and IST4_KYO1 (25) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA LT Kit), with 8 cycles of PCR ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... Samples were confirmed to have sufficient quality with Agilent Bioanalyzer before undergoing library preparation by Tufts University Genomics Core using the TruSeq stranded mRNA kit (20020594; Illumina; San Diego, CA). Samples were run on a HiSeq2500 platform at a depth of 50 million single-end 50 base pair reads to allow for transcript quantitation64 ...
-
bioRxiv - Cell Biology 2021Quote: ... Approximately 0.4 - 1 μg of total RNA were used to prepare small RNA cDNA libraries utilizing the specified protocol for the TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, USA). Single-read sequencing of 50 bp was performed on an Illumina Hiseq 2500 at LC Sciences LLC (Houston ...
-
bioRxiv - Cell Biology 2021Quote: ... The libraries were added in equal molecular amounts and were sequenced on an Illumina Next-seq DNA sequencer with a 75-bp pair-end cycle sequencing kit (Illumina, San Diego, CA). The detected reads were analyzed using CLC Genomics Workbench software (ver.8.01 ...
-
bioRxiv - Neuroscience 2020Quote: ... Library preparation for RNA-Seq was performed using the TruSeq™ RNA Sample Prep Kit v2 (Illumina, Cat. N°RS-122-2002, USA) starting from 50 ng of total RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... Library preparation was performed by capture of sequence-specific coding RNA using 40 ng of total RNA and the TruSeq RNA Access Library Prep Kit (Cat No RS-301-2001, Illumina, San Diego, USA). Libraries were sequenced as paired-end 68 bp reads on a HiSeq2000 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Approximately 500 μg of total RNA was used as input for the TruSeq Stranded mRNA Library Prep kit (Illumina, Inc., San Diego, CA); and library preparation was carried out following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA from infected barley leaves at 6 days post-inoculation (dpi) was isolated by using the MasterPure™ Complete DNA&RNA purification Kit (Epicentre®, Illumina®) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Libraries were prepared from single frond samples using 1μg starting RNA using the TruSeq RNA library prep kit V2 (Illumina Systems, San Diego, USA) and quantified by KAPA library quantification (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries for purified PCR amplicons were constructed using an Illumina TruSeq Nano DNA LT Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... One μg of DNase-treated total RNA was used for library construction using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc, CA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The consortium metagenomic library was prepared with 200 ng of starting material using the TruSeq DNA Nano kit (Illumina, San Diego, CA, USA) and paired-end sequenced (2×100 bp ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA library preparation was performed using 1μg of total RNA with a TruSeq Stranded mRNA Library Preparation Kit High Throughput (Illumina, San Diego, California, USA) according to manufacturer’s instructions (Catalog # RS-122-9004DOC ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing amplicon pools were diluted to 0.2 ng/µl and tagmented with Nextera XT library prep kit (Illumina, Cat#FC-131-1024). Nextera libraries were dual-barcoded and sequenced on an Illumina NextSeq1000 instrument ...
-
bioRxiv - Genomics 2020Quote: ... we constructed a sequencing library (insert size of 500 bp) with TruSeq DNA PCR-Free Library Prep Kit (Illumina, San Diego, CA, USA) to sequence on HiSeqX (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: Paired-end DNA and cDNA libraries (2 × 150 bp) were constructed using TruSeqTM DNA Sample prep kit (Illumina Inc., San Diego, CA, USA) and TruSeqTM RNA Sample prep kit (Illumina Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was sent to Beijing Genomics Institute for library prep with the TruSeq small RNA sample preparation kit (Illumina, San Diego, California) and sequencing by 50 bp single end sequencing with the BGISEQ-500 platform ...
-
bioRxiv - Microbiology 2021Quote: ... Preparation of cDNA libraries was performed according to the manufacturer’s instructions for the TruSeq stranded mRNA kit (Illumina, San Diego, CA, United States). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: Total RNA from tissues was converted to cDNA with SuperScript IV and sequencing libraries prepared with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024). Sequencing was performed using the Illumina NextSeq platform with 150bp paired-end reads ...
-
bioRxiv - Microbiology 2020Quote: ... For all 2018 samples sequencing was performed using an Illumina MiSeq and the MiSeq Reagent Kit v2 (Illumina, Inc., San Diego, CA, USA) for 2 sets of 250 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... One µg total RNA from each sample was used to generate a paired-end RNA-seq library by polyA mRNA workflow using TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA). Each library was subjected to sequence in Illumina Novaseq 6000 (2 × 150bp read length ...
-
bioRxiv - Cancer Biology 2020Quote: ... All the cell line mRNA libraries for sequencing were prepared according to the TruSeq Stranded Total RNA Library Prep Kit (Illumina, #RS-122-2201). Sequencing (75 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... University of Pittsburgh sample libraries were manually prepared via standard protocols using the Illumina TruSeq RNA Exome Library Prep Kit (Illumina, San Diego, CA) and sequenced on an Illumina NextSeq sequencing system using NextSeq 500 Mid- and High-Output 150 cycle kits (75 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on an Illumina NextSeq sequencing system using NextSeq 500 Mid- and High-Output 150 cycle kits (75 bp, paired-end; Illumina, San Diego, CA). Quality control was performed on the raw reads using RNA-SeQC (v1.1.7) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 ng of the amplified cDNA was converted into the sequencing library with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024), according to the protocol supplied ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing were performed on the Illumina HiSeq 4000 paired end at 2x 100 bp (2x at least 40 million reads) using the TruSeq SBS Kit v4-HS (Illumina, Inc, California, USA).
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was normalized to 100 ng prior to random hexamer priming and libraries generated using the TruSeq Stranded Total RNA - Globin kit (Illumina, San Diego, USA). Libraries were assessed on the Fragment Analyzer using the High Sense Large Fragment kit and quantified using a Qubit 3.0 fluorometer (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA samples were converted to RNA-seq libraries with the TruSeq Stranded Total RNA Library Preparation Gold kit (Illumina, San Diego, CA, USA). This kit was reported to reliably and reproducibly generate libraries from 1-2 ng input RNA (Schuierer et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... After chemical fragmentation by incubating for 15 min at 94°C the sample was directly subjected to the workflow for strand specific RNA-Seq library preparation (NEBNext® Ultra™ RNA Library Prep Kit for Illumina®). For ligation custom adaptors were used (Adaptor-Oligo 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The mRNA was subsequently fragmented and used for cDNA synthesis and library preparation using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Paleontology 2022Quote: ... DNA extracted from mammoth and sloth boluses were sequenced on an Illumina MiSeq using the 600-cycle v3 kit (Illumina, MS-102-3003), whereas the elephant and modern and paleontological bison samples were sequenced on an Illumina NextSeq 500 system ...
-
Dynamic chromatin organization and regulatory interactions in human endothelial cell differentiationbioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were prepared from total RNA (≥200 nucleotides in length) using the TruSeq Stranded Total RNA Ribo-Zero H/M/R kit (Illumina, RS-122-2201). Libraries were paired-end sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Cancer Biology 2022Quote: Total RNA libraries (COR-L279) and mRNA libraries (H446 and LX22) were constructed using a TruSeq Stranded Total RNA Kit (Illumina, RS-122-2201) and an mRNA Library Prep kit V2 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing was performed on the Illumina HiSeq 4000 paired end at 2 X126 bp or single end 126 bp using the TruSeq SBS Kit v4-HS (Illumina, Inc, California, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.4 μg total RNA was used for RNA-seq library construction by a TruSeq RNA Library Prep Kit V2 (Illumina, RS-122-2001). Both ChIP-seq and RNA-seq libraries were sequenced at the Bauer Core Facility ...
-
bioRxiv - Neuroscience 2022Quote: ... A sequencing library was produced using 0.75 ng of the amplified cDNA in the Nextera XT Library Preparation Kit (Illumina, cat # FC-131-1024). For astrocyte RNA-seq ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200ng of total RNA was used in the reactions for the Illumina TruSeq stranded RNA-seq library preparation kit (Illumina, RS-122-2101) according to the manufacturer’s instructions with the modification to use Superscript III Reverse Transcriptase enzyme (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: RNA molecules extracted from input and output preparations were used for library preparation using the TruSeq stranded total RNA library prep kit (Illumina, San Diego, California), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... paired-end library was prepared using 100 ng of DNA with the Nextera DNA sample preparation kit as per the manufacturer’s instructions (Illumina, Inc., San Diego, USA). This was followed by sequencing on Illumina NextSeq 500 and HiSeq X 10 platforms with a paired-end run of 2×150 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... and approximately 150 ng of RNA was subjected to rRNA depletion using the Ribo-Zero Gold rRNA Removal Kit (Yeast) (Illumina MRZY1324, now discontinued). Libraries were prepared using the TruSeq Stranded Total RNA kit (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcoded libraries were then pooled at equimolar ratios and sequenced on a NextSeq500/550 instrument (Illumina, 150 cycles High Output kit v2.0) to generate 150-bp single-end reads ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1ug of total RNA was then used to generate sequencing libraries using the TruSeq RNA Sample prep kit v2 (Illumina RS-122-2001), as per recommended instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Next the amplicons were checked for their size and purity on a 1.5 % agarose gel and if suitable subjected to the index PCR using the Nextera XT Index Kit v2 Set C/D (Illumina, FC-131-2003). After index PCR the samples were cleaned again with AmPure XP Beads (Beckman Coulter Life Science Cat ...
-
bioRxiv - Microbiology 2020Quote: ... The genome was sequenced with Illumina technology using a GAIIx sequencing platform on paired-end libraries prepared with the Nextera XT DNA Kit (Illumina, San Diego, CA). A total of 84 contigs (0.5 to 330 kb ...
-
bioRxiv - Plant Biology 2021Quote: RNA-seq libraries were constructed by the POPS platform (IPS2) using the TruSeq no stranded mRNA library prep kit (Illumina®, California, U.S.A.) according to the supplier’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Library preparation and sequencing of the samples were conducted at the Mayo Clinic Genome Analysis Core using TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA). The library was sequenced on Illumina HiSeq2000 instruments ...