Labshake search
Citations for Bioline :
1301 - 1350 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using the Bioline Isolate II PCR and Gel kit (Bioline, Cat. No. BIO-52060). Samples were sequenced using the Illumina Miseq platform ...
-
bioRxiv - Genetics 2020Quote: ... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complexbioRxiv - Molecular Biology 2020Quote: ... Semi-quantitative PCR was carried out with MyTaq Red Mix (Bioline). Quantitative real time PCR was performed with 16 ng of cDNA per reaction with GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Genetics 2020Quote: ... 100 ng of sonicated template was used for T7-mediated IVT using the MEGAscript T7 Transcription Kit (ThermoFisher #AMB13345, supplemented with Ribosafe RNAse Inhibitor (Bioline #BIO-65028)) ...
-
bioRxiv - Microbiology 2020Quote: ... but with the polymerase MangoTaq (Bioline, Luckenwalde, Germany), using the following thermal conditions ...
-
bioRxiv - Microbiology 2020Quote: ... 0.2 mM of each dNTP (Bioline, Luckenwalde, Germany), 0.2 μM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 units of MyTaq HS (Bioline, BIO-21112), and 1 µL of the purified PCR product from the previous step ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 units of MyTaq HS (Bioline, BIO-21112), and 1 µL of the eluted bisulfite converted DNA (∼12.5 ng) ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2020Quote: cDNA was diluted 1:10 in nuclease-free water and subsequently applied for qRT-PCR using the SensiFast™SYBR HiROX Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was transcribed using 1µg RNA and sensiFAST cDNA Synthesis Kit (Bioline) following the instructions of the manufacturer.
-
bioRxiv - Systems Biology 2020Quote: ... Naïve and primed marker expression was determined by qPCR using the Sensifast SYBR No Rox-Kit (Bioline). Primers are listed in Supplementary Table 6.
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was transcribed using the SensiFAST cDNA Synthesis Kit (Bioline). Naïve and primed marker expression was determined by qPCR using the Sensifast SYBR No Rox-Kit (Bioline) ...
-
bioRxiv - Genetics 2020Quote: ... First strand cDNA was synthesized using SensiFAST™ cDNA Synthesis Kit (#BIO-65054, Bioline, Italy) following manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... First strand cDNAs were synthesized using SensiFAST™ cDNA Synthesis Kit (#BIO-65054, Bioline) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT–PCR (qRT–PCR) was carried out using the SensiFast™SYBR Hi-ROX One-Step Kit (Bioline) as described (Wobbe et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA samples were prepared using the SensiFAST SYBR Lo-Rox kit (Bioline, BIO-94020), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Sensifast SYBR No Rox-Kit (Bioline, BIO-98020). Expression levels were normalized to either L32 or Actin ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was retrotranscribed from 0.3 µg to 1 µg using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054). Real-time PCR was performed on the CFX384 Touch Real-time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... total RNA was isolated using the ISOLATE II RNA Mini Kit (BIO-52O72, Bioline, London, UK) according to manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... total RNA of both uninfected and DENV1-infected samples were subjected cDNA synthesis using Tetro cDNA synthesis kit (Bioline, BIO-65042). Reverse oligo of DENV1 specific primer was used in cDNA synthesis ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10-50 ng of RNA were used for reverse transcription with SensiFAST cDNA synthesis kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA synthesis was carried out using SensiFAST cDNA Synthesis Kit from BIOLINE. Quantitation of all gene transcripts was done by qPCR using SYBR Green (Applied Biosystems ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... or Isolate II PCR and Gel Kit (Bioline cat# BIO-52059) according to the manufacturer’s protocols ...
-
bioRxiv - Genetics 2020Quote: ... SensiFAST SYBR No-ROX kit from Bioline, and a Biorad CFX Connect instrument ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 unit Biolase Taq (Bioline, Boston, MA), and 1 μl of template DNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... With a standard qualitative PCR (0.125 My Taq™ polymerase (Bioline), 5μl 5x buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We labeled each library with a sample-specific pair of barcodes and combined libraries in equimolar ratios based on qPCR using SensiFAST SYBR Hi-ROX master mix (Bioline), then sequenced the combined pools on four lanes of 50bp single end reads (Illumina HiSeq2500 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mM dNTP (Bioline, Boston, MA), 250 nmol forward and reverse primers (IDT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1X NH4 Buffer (Bioline, Boston, MA), 3 mM MgCl (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with a MyTaq HS Red Mix PCR kit (Bioline, Eveleigh, Australia). Each 20 μL reaction contained 5 μL of MilliQ water ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted using a Bioline Isolate II Genomic DNA Isolation Kit (Bioline, Eveleigh, Australia) following the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNAs were converted to cDNA using the Sensifast cDNA synthesis kit (Bioline, BIO-65053). The cDNAs were then amplified by PCR by using specific primers for each gene designed on the Primer-blast software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using the NucliSENS® EasyMag® (BioMérieux, Marcy l’Etoile, France) or the Isolate II Genomic DNA kit (Bioline, Tennessee, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized with the SensiFAST Kit (Bioline, Alexandria, Australia). Fluorescence reflecting target genes expression was determined by the SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Plant Biology 2020Quote: ... Fluorescence reflecting target genes expression was determined by the SensiFAST SYBR No-ROX Kit (Bioline, Australia) using gene-specific primers (Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 ng total RNA was used in each single-step reaction according to the manufacturer’s instruction (HiRoxSensifast Kit, Bioline). Primers (LHCSR3 fw/rev ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.1 μl of MyTaq (Bioline), and 2 μl of DNA were used ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5-1 μg of total RNA was retrotranscribed using SensiFAST cDNA Synthesis Kit (BioLine, London, UK). Real-time PCR was performed using iTaq qPCR master mix according to manufacturer’s instructions (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... The Sensifast SYBR no-rox Kit (ref. BIO-98005, Bioline) and a Rotor Gene Q Real-Time PCR (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription of 500 ng of motor cortex RNA was performed using the Tetro cDNA Synthesis kit (Bioline, Meridian Bioscience, USA) with random hexamer primers according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µg of total RNA was used to prepare cDNA with SensiFast cDNA synthesis kit (Bioline) according to the manufacturer’s instructions and diluted 1:6 with DNAse/RNAse-free water (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
bioRxiv - Bioengineering 2020Quote: ... using the SensiMix™ Kit and SYBRGreen (Bioline, Luckenwalde, Germany). For each triplicate cDNA amounts corresponding to 50 ng RNA were used and measurements were conducted in a LightCycler® 480 (Roche ...
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesized with SensiFast (Bioline, BIO-65053). TaqMan® Fast Advanced Master Mix and the following TaqMan Gene Expression Assays (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: ... The resulting cDNA was amplified and quantified using SYBR Green PCR Master Mix (Bioline) in QuantStudio 6 Flex ...
-
bioRxiv - Molecular Biology 2020Quote: ... including 10 μl of 10 mg/ml BSA solution and 5 μl of HyperLadder 1 kb (BIOLINE), 200 μl of the filtered cell lysates was injected onto the pre-equilibrated SEC column ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was performed using C1000 Touch Thermal Cycler (BioRed) and SYBR mix (Bioline, GmbH, Germany), using validated primer sets (Herber et al ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10-50 ng of RNA was reverse transcribed with Sensifast cDNA synthesis kit (Bioline, London, UK). DRG axonal purity was assessed by RT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... target cDNA sequences were amplified for 35 reaction cycles with the enzyme MyTaq DNA Polymerase (Bioline). The cDNA of the housekeeping gene ATP5O (ATP synthase ...