Labshake search
Citations for Bioline :
951 - 1000 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... SensiFAST™ SYBR® Hi-ROX Kit (Bioline) in QuantStudio™ 5 (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... from Bioline. To represent final results after two-step chromatin immunoprecipitation ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiFAST Sybr No-Rox mix (Bioline, Cat No BIO98020) from Bioline ...
-
bioRxiv - Plant Biology 2021Quote: ... from Bioline. Three biological replicates were used in each experiment ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiFAST Sybr No-Rox mix (Bioline, Cat No BIO98020) from Bioline ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiFAST Sybr No-Rox mix (Bioline, Cat No BIO98020) from Bioline ...
-
bioRxiv - Plant Biology 2021Quote: ... from Bioline. Primers used in this experiment are summarized in Table S4 ...
-
bioRxiv - Plant Biology 2021Quote: ... including 666 nM of each primer and 1x SensiFAST SYBR No-ROX mix (BIOLINE). Primers were designed to anneal outside the 200 bp VIGS target sequence (Table ...
-
bioRxiv - Cell Biology 2021Quote: ... and the SensiFAST™ SYBR® No-ROX Kit (Bioline), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from cells seeded on hydrogels using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was isolated from at least 10 midguts using the Isolate II RNA Mini kit (Bioline, UK). The extracted RNA was quantified using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... The interaction between the protein products fused to the DNA binding and activation domains were analyzed by the activity of β-galactosidase by the cleavage of X-Gal (BIO-37035, Bioline, UK). For detecting the β-galactosidase activity overlaying of low melting agarose with X-Gal (over lay mix was prepared freshly) ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng of RNA were converted to cDNA by the Tetro cDNA Synthesis Kit (Bioline, London, UK) and a mixture of oligo-dT and random hexamer primers.
-
bioRxiv - Synthetic Biology 2021Quote: ... We performed colony PCR using BioRed PCR mix (Bioline) to screen for genome modifications ...
-
bioRxiv - Synthetic Biology 2021Quote: ... dNTPs were obtained from Bioline.
-
bioRxiv - Synthetic Biology 2021Quote: ... The approximately 75bp M13 fragment was amplified from linear double stranded DNA template (gBlock-CaM-Linker-M13, IDT) using Accuzyme DNA polymerase (Bioline) using DNA primers P21 – P28 listed in Table 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Real-time quantitative PCR was performed using the Sensimix SYBR low-rox kit (Bioline) and the primers in Supplementary Table 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative PCR (qPCR) was performed using the Sensimix SYBR low-rox kit (Bioline, Memphis, USA) on a 7500 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesised using BioScript™ (Bioline). RNA for semi-qRTPCR was extracted using a Trizol buffer method ...
-
bioRxiv - Plant Biology 2021Quote: ... the qPCR mixtures were prepared with 12.5 μL of SYBR Green mix (Bioline, London, UK), 10 μL of DNA (final amount 100 ng) ...
-
bioRxiv - Plant Biology 2021Quote: ... The qPCR mixture contained 7.5 μL of SYBR Green (Bioline, London, UK), 5 μL of cDNA (corresponding to 100 ng RNA) ...
-
bioRxiv - Plant Biology 2021Quote: ... 3-day-old etiolated hypocotyls or roots were mounted in water under a pad of 0.8% agarose (Bioline). To limit the time that seedlings spent mounted ...
-
bioRxiv - Genomics 2021Quote: ... 1 × MyTaq™ Red Mix (Bioline), 10 pmoles each primer and 0.25 μL (1.25 U ...
-
bioRxiv - Genomics 2021Quote: ... 10 pmoles each primer and 0.25 μL (1.25 U) MyTaq DNA Polymerase (Bioline). Thermal cycling conditions were 95°C for 1 min followed by a 5-cycle touch-down (95°C for 30 s ...
-
bioRxiv - Microbiology 2021Quote: ... the 15 μl PCR reaction mixture contained 1x MyTaq™ Red PCR Mix (Bioline, South Africa), 0.2 μM primers ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real time-PCR (qRT-PCR) analysis was performed in triplicate on 50 ng cDNA using the SensiFAST SYBR & Fluorescein kit (Bioline) and a Roche Lightcycler 96 ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized (Bioline) using random hexamers (26) ...
-
bioRxiv - Microbiology 2021Quote: ... A 25 µl reaction mixture contained 1x MyTaq Red PCR Mix (Bioline, South Africa), four species-specific forward primers and reverse primer IS711 (Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... The 15 µl PCR reaction mixture contained 1x of MyTaq ™ Red PCR Mix (Bioline, South Africa), primers at 0.2 µM ...
-
bioRxiv - Microbiology 2021Quote: ... A 25 µl PCR reaction contained 1x MyTaq ™ Red Mix (Bioline, South Africa), eight species-specific forward and reverse primers at a final concentration of 6.25 µM (Table 1) ...
-
bioRxiv - Microbiology 2021Quote: The origin of viral genes present in samples were determined by gene-specific reverse transcription polymerase chain reaction (RT-PCR) using a SensiFast Probe No-ROX one-step reverse transcription kit (Bioline, Meridian Biosciences, Ohio, USA). Each 20 µL reaction contained 5 μl of virus sample in 0.05% Triton-X 100 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral vRNA and mRNA were detected by polarity-specific quantitative RT-PCR using the SensiFast Probe No-ROX one-step kit (Bioline). Each 20 µL reaction contained 5 μl of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Vectors for mutant nsp14 expression were generated by QuikChange site-directed mutagenesis using Accuzyme DNA polymerase (Bioline) and verified by sequence analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5μl of 10 x Buffer (Bioline), 1.25μl of 50mM MgCl2 (Bioline) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using Bioscript reverse transcriptase (Bioline), Random Primers (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using SensiFAST SYBR & Fluorescein Kit (Bioline) as previously described (25,32) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was done using 10 ng (broth culture) or 100 ng (fecal samples) of genomic DNA as template with SYBR Green Real-Time qPCR reagents (Bioline), primers at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified by using the Isolate II PCR and gel kit (Bioline), analyzed by agarose gel electrophoresis and then sequenced (GATC Biotech ...
-
bioRxiv - Microbiology 2021Quote: ... 25 μL of BioMix Red (Bioline) and DEPC-treated water up to a total reaction size of 50 μL mixed into 0.2 mL PCR tubes ...
-
bioRxiv - Microbiology 2021Quote: ... and MyTaq HS Red Mix (Bioline, London, UK). PCR conditions are described in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR (qPCR) reactions (20 μl) included 1X SensiMix SYBR green master mix (Bioline), 0.5 μM of each primer and 5 μl template cDNA (used at 1:200 dilution in RNase-free water) ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... cDNA synthesis was performed with 1 µg RNA (SensiFAST™ cDNA Synthesis Kit, Bioline, Cat# BIO-65053), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: RNA precipitation was performed with TRIsure™ (Bioline, London/UK) following to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was removed and 500μL of TRIsureTM (Bioline Reagents) was immediately applied to the biofilms ...
-
bioRxiv - Plant Biology 2021Quote: ... using SensiFAST SYBR No-ROS kit (Bioline, BIO-98020). PCR was set up as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed using an oligo d(T) primer and Tetro Reverse Transcriptase (Bioline). We performed qRT-PCR using the primers in Supplemental Table 1 and SYBR green supermix ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons for sequencing were generated by PCR using degenerate primers (see Supplemental Table 1) for each locus using My Taq HS mix (Bioline) and gel purification ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR of protonema samples was conducted using the SensiFastTM SYBR No-ROX Kit (Bioline, Luckenwalde, Germany) in a LightCycler 480 (Roche ...