Labshake search
Citations for Bioline :
801 - 850 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... ChIP DNA and input DNA were diluted 5X and amplified using 500 nM primers and SensiFAST SYBR (No-ROX Kit, Bioline) using a LightCycler 480 (Roche).
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed with 1/10 diluted cDNA with the SensiFAST SYBR no-rox kit (Bioline, London, UK) and Lightcycler® 480 (Roche Molecular Biochemicals ...
-
bioRxiv - Microbiology 2022Quote: ... then the number of genomes was quantified by SensiFAST™ SYBR® & Fluorescein Kit (Bioline) and CFX96 Touch Real-Time PCR Detection System (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR using MyTaq DNA polymerase (Bioline). Following amplification ...
-
bioRxiv - Microbiology 2022Quote: ... 500-ng portions of DNA extracted from each larva were subjected to qPCR using the SensiMic SybR Green kit (Bioline). Forward (5′-ACTTCCGCAATGGACGTTAC-3′ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR was performed (10 cycles) to amplify the tagmented DNA with sequencing adapters using 2x MyTaq (BIO-25041; Bioline). The PCR products were cleaned using Serapure beads and pooled together prior to sequencing ...
-
bioRxiv - Genomics 2022Quote: ... The double stranded cDNA was purified using JetSeq Beads (Bioline, Cat # BIO-68031). Purified cDNA was end-repaired ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotyping was performed using Immomix mix red (Bioline) for Cre (Fwd 5’-TCAGCAGGTTGGAGACTTTC ...
-
bioRxiv - Genomics 2022Quote: ... and run on a 2% agarose gel (Bioline, Cat#: BIO-41025) pre-stained with SYBR Safe Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl 2X BioMix Red (Bioline) and ddH2O ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was amplified in triplicate with SensiFast Probe No-Rox One-Step Kit (Bioline) and gene-specific Taqman primers (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Isolated RNA was converted into cDNA using the SensiFAST™ cDNA synthesis kit (Bioline). Quantification of the relative amount of specific mRNAs was done using quantitative real time PCR in a 96-well plate with the StepOne™ Real PCR system ...
-
bioRxiv - Plant Biology 2022Quote: TRIsure™ Reagent (Bioline) was used to extract RNA from seedlings ...
-
bioRxiv - Physiology 2022Quote: ... RNA was reverse transcribed using a SensiFast cDNA Synthesis Kit (Bioline, London, United Kingdom). cDNA was amplified in triplicate with SensiFast Probe No-Rox One-Step Kit (Bioline ...
-
bioRxiv - Plant Biology 2022Quote: ... patens cDNA was synthesised using the Tetro cDNA synthesis kit (Bioline) with OligodT primers as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNA was synthesised using SensiFAST cDNA synthesis kit before amplification against transcripts by qRT-PCR kit with SYBR green (Bioline). Alternatively ...
-
bioRxiv - Cancer Biology 2022Quote: ... fresh frozen tumor tissue were placed in 1 ml of TRIsure reagent (#BIO-38032, Bioline) and tissue lysis was achieved by high-speed shaking with stainless steel beads for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... transcripts were amplified directly on RNA samples using a one-step qRT-PCR kit with SYBR green (Bioline). Primers used against DDIT3 (CHOP ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using SensiFAST™ SYBR kit (BIOLINE). The primer sequences used for qPCR are listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: We used SensiFast (Bioline, UK) to carry out the qPCR reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles ...
-
bioRxiv - Systems Biology 2022Quote: ... followed by quantitative RT-PCR (RT-qPCR) using the SensiMix SYBR kit (Bioline). Expression analysis of genes of interest was performed on a Rotor-Gene Q (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was conducted with SensiFast SYBR lo- ROX Kit (Bioline) on a Quant Studio 6 Flex real-time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Synthetic Biology 2022Quote: ... each well contained 1 mL LB agar supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... LB medium was supplemented with 2 mM IPTG (Bioline), 5 μg/mL chloramphenicol (MilliporeSigma) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Electrophoresis of the Round 2 Multiplex-Nested-PCR product was performed on a 1% agarose (Molecular grade, Bioline) gel ...
-
bioRxiv - Systems Biology 2022Quote: ... First-strand cDNA was generated using BioScript (Bioline) and random hexamer primers ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Hippocampus tissue punches were stored in 200 µL TriSure Reagent (BioLine, Meridian Bioscience ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was synthesized from 1 µg RNA samples using SensiFAST cDNA synthesis kit (Bioline) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... RNA samples (1 µg) were reverse transcribed using SensiFAST cDNA synthesis kit (Bioline) according to manufacturer’s protocol and subjected to Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Biochemistry 2022Quote: ... A total reaction volume of 20 μL containing 1x SensiFAST SYBR Lo-ROX mix (Bioline), 200 μM of each forward and reverse primer ...
-
bioRxiv - Molecular Biology 2022Quote: Whole frozen iBAT samples were homogenised in 1 ml TRIsure (Bioline, Memphis, Tennessee, USA) per animal using a tabletop homogeniser (FastPrep-24 5G ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1x SensiFast SYBR no-rox mastermix (Bioline), 10 ng gDNA and the following cycling conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared for RT-qPCR using the SensiFAST cDNA preparation kit according to manufacturer instructions (Bioline #65054). 1μL of cDNA was used per RT-qPCR reaction prepared with SYBR Lo-ROX (Bioline #94020) ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were plated at 1M/mL and harvested in TRIsure (Bioline #38033). RNA was extracted using Direct-zol RNA MicroPrep columns (Zymo #R2062 ...
-
bioRxiv - Microbiology 2022Quote: ... and qPCR was performed with the SensiFAST No-ROX Master Mix (Bioline), all according to manufacturer’s instructions on a Bio-Rad CFX96 qPCR machine ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was diluted 30-fold and 5μl were used for qPCR using SensiMix SYBR low-ROX (Bioline) with 150nM Forward and Reverse primers (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... The qRT-PCR reaction was performed using 35 µL SensiFAST™ Probe Lo- ROX One-Step Kit (Bioline, Taunton, MA) and 15 µL of extracted eluate ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were size separated by gel electrophoresis on a gel composed of 2% DNA grade agarose (Bioline) in TAE buffer (40 mM Tris Acetate ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed using SensiMix™ SYBR® No-ROX Kit (QT650-05, Bioline) in a QuantStudio™ 6 Flex System (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: qPCR was performed on each of the samples using an Applied Biosystems StepOnePlus system with a Sensifast Hi-Rox Sybr kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... qRT-PCR was carried out on 1:2 diluted cDNA on an Applied Biosystems StepOnePlus system using a Sensifast Hi-Rox SYBR kit (Bioline). Cycle conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... Isolated RNA was used (1 μg) to make cDNA using SensiFASTTM Kit (Bioline Cat. Bio-65053). qPCR master mix was prepared using iTaq universal SYBR green supermix (Bio-Rad Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1μL of cDNA was used per RT-qPCR reaction prepared with SYBR Lo-ROX (Bioline #94020). For sequencing library preparation ...
-
bioRxiv - Neuroscience 2022Quote: ... Dehydrated samples were rehydrated through a series of methanol/PBS washes for 10 minutes each at room temperature with an additional 3 x 10 minutes PBSTw (0.1% Tween-20) and treated with proteinase K (1:1000, Bioline) for 20 minutes to increase permeabilization ...
-
bioRxiv - Immunology 2022Quote: ... Purified nucleic acid was then immediately converted to cDNA by reverse transcription with random hexamers using the SensiFAST cDNA Synthesis Kit (Bioline Reagents, UK) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were done using 2x SensiFAST Mix (Bioline, London, UK) and analysed in a Lightcycler 480 II (Roche ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative PCR was performed with the SensiFAST™SYBR® No-Rox Kit (Bioline) using 1.25 ng per reaction ...
-
bioRxiv - Physiology 2021Quote: ... using the SensiFAST™cDNA Synthesis Kit (Bioline). Quantitative PCR was performed with the SensiFAST™SYBR® No-Rox Kit (Bioline ...