Labshake search
Citations for Bioline :
801 - 850 of 1617 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... A 25 µl PCR reaction contained 1x MyTaq ™ Red Mix (Bioline, South Africa), eight species-specific forward and reverse primers at a final concentration of 6.25 µM (Table 1) ...
-
bioRxiv - Microbiology 2021Quote: The origin of viral genes present in samples were determined by gene-specific reverse transcription polymerase chain reaction (RT-PCR) using a SensiFast Probe No-ROX one-step reverse transcription kit (Bioline, Meridian Biosciences, Ohio, USA). Each 20 µL reaction contained 5 μl of virus sample in 0.05% Triton-X 100 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral vRNA and mRNA were detected by polarity-specific quantitative RT-PCR using the SensiFast Probe No-ROX one-step kit (Bioline). Each 20 µL reaction contained 5 μl of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Vectors for mutant nsp14 expression were generated by QuikChange site-directed mutagenesis using Accuzyme DNA polymerase (Bioline) and verified by sequence analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5μl of 10 x Buffer (Bioline), 1.25μl of 50mM MgCl2 (Bioline) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using Bioscript reverse transcriptase (Bioline), Random Primers (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed using SensiFAST SYBR & Fluorescein Kit (Bioline) as previously described (25,32) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was done using 10 ng (broth culture) or 100 ng (fecal samples) of genomic DNA as template with SYBR Green Real-Time qPCR reagents (Bioline), primers at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified by using the Isolate II PCR and gel kit (Bioline), analyzed by agarose gel electrophoresis and then sequenced (GATC Biotech ...
-
bioRxiv - Microbiology 2021Quote: ... 25 μL of BioMix Red (Bioline) and DEPC-treated water up to a total reaction size of 50 μL mixed into 0.2 mL PCR tubes ...
-
bioRxiv - Microbiology 2021Quote: ... and MyTaq HS Red Mix (Bioline, London, UK). PCR conditions are described in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR (qPCR) reactions (20 μl) included 1X SensiMix SYBR green master mix (Bioline), 0.5 μM of each primer and 5 μl template cDNA (used at 1:200 dilution in RNase-free water) ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... cDNA synthesis was performed with 1 µg RNA (SensiFAST™ cDNA Synthesis Kit, Bioline, Cat# BIO-65053), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: RNA precipitation was performed with TRIsure™ (Bioline, London/UK) following to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was removed and 500μL of TRIsureTM (Bioline Reagents) was immediately applied to the biofilms ...
-
bioRxiv - Plant Biology 2021Quote: ... using SensiFAST SYBR No-ROS kit (Bioline, BIO-98020). PCR was set up as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... 35 rounds of PCR were performed using Mango Taq (Bioline) under standard conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed using an oligo d(T) primer and Tetro Reverse Transcriptase (Bioline). We performed qRT-PCR using the primers in Supplemental Table 1 and SYBR green supermix ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplicons for sequencing were generated by PCR using degenerate primers (see Supplemental Table 1) for each locus using My Taq HS mix (Bioline) and gel purification ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR of protonema samples was conducted using the SensiFastTM SYBR No-ROX Kit (Bioline, Luckenwalde, Germany) in a LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2021Quote: RNA from GP barley infected with Fg-IFA65 at 5 dpi and an uninfected control was extracted with the Isolate II plant miRNA kit (Bioline). 1 µg of RNA (>200 nt ...
-
bioRxiv - Microbiology 2021Quote: qRT-PCR was used to quantify transcript levels of specific quorum sensing-controlled genes in DS40M4 and was performed using the SensiFast SYBR Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: Real-time qRT-PCR (quantitative reverse transcription PCR) was used to quantify transcript levels using the SensiFast SYBR Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from the enriched viral nucleocapsids using the Isolate II genomic DNA kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of DpnII-digested fragments using MyTaq (Bioline, BIO-21112) enriched for methylated fragments before samples were sonicated and prepped for sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... First strand synthesis was performed using Bioscript (Bioline). mRNA expression levels were quantified using SYBR-Green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were lysed in TriSure (Bioline) and RNA was extracted according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Bands of correct size were cut out and purified using the Isolate II PCR and gel kit (Bioline). 50 ng of vector and 150 ng of each fragment were mixed with 3 μl of HiFi DNA Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... using random primers (Bioline, UK). One µl of cDNA was specifically and quantitatively amplified using Biotool 2x SybrGreen qPCR master mix (Stratech ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted using the Isolate II RNA Mini kit (Bioline, UK). 1-3 µg were reverse transcribed with a MuLV reverse transcriptase (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX qPCR kit (BioLine). rp49 was used as a housekeeping gene for ΔΔCt calculations ...
-
bioRxiv - Cell Biology 2021Quote: ... and cDNA was synthesised with SensiFast cDNA synthesis kit (Bioline, London, UK) according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2021Quote: ... After PCR verification in agarose gel and PCR clean-up using the ISOLATE II PCR and Gel Kit (Bioline), the remaining plasmid template was digested with DpnI at 37°C for 3h ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reactions were set up using SensiFast 2× Mastermix (Bioline Cat# BIO-94020) and oligonucleotides targeting genes of interest (IDT ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA from each sample were reverse transcribed to cDNA using the Bioline SensiFAST cDNA Synthesis kit (Bioline, Cat# BIO-65054). The cDNA was diluted 13-fold in ddH2O and 4 uL of this dilution was used for each quantitative real-time PCR (qPCR) ...
-
bioRxiv - Cell Biology 2021Quote: ... or The SensiMix™ SYBR® No-ROX (BioLine) protocols for Real TimeOne-Step RT-PCR using the Real Time Rotor-GeneRG-3000™ light cycler from Corbett Research using primers listed in Supplementary Table IV.
-
bioRxiv - Microbiology 2021Quote: ... and 1.25 U BIOTAQ™ DNA Polymerase (Bioline, London, UK). A Mastercycler Nexus GSX1 (Eppendorf ...
-
bioRxiv - Cancer Biology 2021Quote: ... and qPCR reactions were conducted using gene-specific primers with SensiFAST SYBR No-ROX kit (Bioline, #Cat no: BIO-98005) as described previously (Sibai et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The conversion of messenger RNA into cDNA was performed using the Sensifast cDNA synthesis kit (Bioline, BIO- 65053). cDNA was then amplified by PCR using specific primers for each gene designed with Primer-blast software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Cell Biology 2021Quote: ... For conventional PCR we used a commercial master mix 2x My Taq HS Mix (Bioline Bio-25046). PCR amplifications were carried out in the T-100 Thermal Cycler (Biorad) ...
-
bioRxiv - Cell Biology 2021Quote: ... or The SensiMix™ SYBR® No-ROX (BioLine) protocols for Real TimeOne-Step RT-PCR using the Real Time Rotor-GeneRG-3000™ light cycler from Corbett Research using primers listed in Supplementary Table IV.
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline, Australia), 0.25 μM of each forward and reverse primer (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Each 20 μL reaction consisted of 10 μL of SensiFAST Probe No-ROX Mix (2×) (Bioline), 0.25 μM each of RamF6 and RamR6 primers (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Microbiology 2021Quote: ... 2μL were used as template for genomic PCRs in a 50 μL reaction with Velocity DNA Polymerase (Bioline#21098) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... the K13 locus was amplified directly from whole blood using the primer pair p26+p27 (Table S9) and the MyTaq™ Blood-PCR Kit (Bioline). Primer pairs p39+p40 and p50+p51 were used to amplify fd and mdr2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized from 1 µg total RNA using cDNA synthesis kit (Bioline, Sydney, Australia) and RT-PCR was performed using the SYBR® Select Master Mix (Thermofisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... washed in water and 100% ethanol prior to RNA extraction using the ISOLATE II RNA Mini Kit’s protocol (Bioline, UK). The extracted RNA was quantified using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR reactions were performed in triplicate using a Corbett Rotorgene 6000 Real-Time PCR machine with Sensimix SYBR No-Rox (Bioline, UK) and intron-spanning primers (Table S1) ...