Labshake search
Citations for Millipore Sigma :
4251 - 4300 of 4702 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: The coding sequences of most of the 44 non-pseudogene AtUMAMIT were amplified by PCR (oligonucleotide sequence is provided in Supplemental Table 1) by using the KOD Hot Start DNA Polymerase kit (Novagen) from a mix of reverse-transcribed RNA extracted from seedlings and inflorescences ...
-
bioRxiv - Microbiology 2021Quote: ... PCR-positive colonies were grown and the vector was extracted using GenElute Plasmid Miniprep Kit following manufacturer’s protocol (Sigma-Aldrich). The vector was then transformed into expression strain E ...
-
bioRxiv - Microbiology 2020Quote: ... for each SmChE were amplified from each full-length template by PCR and cloned into the pET41a expression vector (Novagen) such that the N-terminal GST tag was removed ...
-
bioRxiv - Microbiology 2019Quote: ... Triplicate reactions were started at RT in PCR tubes by addition of an NAD+-mixture resulting to final concentrations of 24.5 µM NAD+ (Sigma, N3014) and 0.5 µM of biotinylated NAD+ (Trevigen ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs were PCR-amplified using specific primers (Table 1) and a JumpStart REDTaq ReadyMix Reaction Mix (Sigma-Aldrich, MO, USA). α-tubulin and water (“no DNA” ...
-
bioRxiv - Microbiology 2020Quote: ... the PCR reaction described above was repeated using genomic DNA isolated using GenElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... The construction of baculovirus transfer vectors encoding hVP3 mutant polypeptides were generated using PCR-based site directed mutagenesis on the pFB/hisVP3 plasmid (Kochan et al. 2003) using synthetic DNA oligonucleotide primers (Sigma) described in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... validated as hex1 deletion mutants by spore PCR and Southern blot analysis (DIG DNA Labeling and Detection Kit, Sigma-Aldrich), and stored as 25% glycerol stocks at −80 °C.
-
bioRxiv - Biochemistry 2021Quote: ... coding sequence was PCR-amplified from genomic DNA (DSM number 40517) and inserted into a modified version of pET-28a(+) (Novagen), which encodes the recognition sequence for Tobacco Etch Virus (TEV ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were routinely tested for mycoplasma contamination on a monthly basis using the LookOut Mycoplasma PCR Detection Kit (Sigma). Any cells yielding positive mycoplasma results were immediately discarded.
-
bioRxiv - Neuroscience 2020Quote: ... the coding region corresponding amino acid 321-475 of dHtt protein was amplified by PCR and cloned into pET28b expression vector (Novagen). To generate anti-CG8134 antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... allele-specific PCRs were performed on 2 µl crude buccal DNA in a total of 10 µl using the REDExtract-N- AmpTM PCR ready MixTM (Sigma) according to the manufacturer’s protocol using 0.5 µM forward ...
-
bioRxiv - Microbiology 2022Quote: ... trachomatis serovar L2 stocks were routinely tested for Mycoplasma contamination using the Mycoplasma PCR detection kit (Sigma, St. Louis, MO).
-
bioRxiv - Genomics 2022Quote: ... Conserved regions were amplified from genomic leaf DNA in a standard polymerase chain reaction (PCR) using specific primers synthesized commercially (Sigma). PCR products were labeled with biotin-16-dUTP or digoxigenin-11-dUTP using BioPrime CGH array labelling kit (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... were amplified by PCR from genomic DNA and cloned into the NcoI/NotI restriction sites of the pET28a vector (Novagen). The constructs were overexpressed in E ...
-
bioRxiv - Neuroscience 2022Quote: ... First-strand synthesis was then performed by incubation at 25 °C for 10 min and 50 °C for 50 min on a PCR cycler with 7.6 μl of the following mix: 0.2 μg actinomycin D (Sigma-Aldrich, A1410), 13.15 mM DTT (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... The 2827-bp PCR product was digested with EcoRI and HindIII and cloned into EcoRI-HindIII-digested pETDuet-1 vector (Novagen) lacking two nucleotides upstream from the BamHI site ...
-
bioRxiv - Genetics 2019Quote: ... Minigenes were constructed by DNA assembly of PCR fragments that were amplified from HEK293T genomic DNA using KOD Hot Start DNA polymerase (Novagen). For the wild-type minigene ...
-
bioRxiv - Cell Biology 2019Quote: ... Biosensors were either made in their original plasmid or in form of PCR fusion-product and were sub-cloned in the pTriEx-4neo vector (Novagen) under NcoI and BamH1 site ...
-
bioRxiv - Plant Biology 2019Quote: Q-PCR was performed on a Roche Lightcycler using standard reverse transcriptase kit and SYBR Green Real-Time PCR Master Mixes (SIGMA).
-
bioRxiv - Neuroscience 2020Quote: ... All DNA fragments were cleaned-up with GenElute™ PCR Clean-Up Kit (Sigma Aldrich Co., St. Louis, MO, USA) prior to PCR analysis ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNAs were amplified by PCR introducing NdeI restriction sites at the start codons and recloned with vector pET30a (Novagen) yielding chimeric fusion constructs with C-terminal hexahistidine-tags.
-
bioRxiv - Physiology 2019Quote: ... for synthesizing the probes was amplified using the primers described in Table S3 as following: the PCR reaction was set with KOD hot start master mix (#71842, Novagen), according to the manufacturer’s instructions and subsequently purified (#28706 ...
-
bioRxiv - Cancer Biology 2020Quote: The cell-lines were confirmed to be mycoplasma negative using the Venor™GeM Mycoplasma Detection PCR kit (MP0025; Sigma).
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from ear clips and amplified by polymerase chain reaction (PCR) using the relevant forward (FP: 5’AAACTGGGCTCTCCGCTGCTG3’) and reverse (RP:5’AGTAGAGTATCGTGCATGGTCCTGG3’) primers (Taq polymerase (Sigma) at an annealing temperature (Tm ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA clones of VF1-mutant viruses that included either a single or a triple stop codon in ORF4 were generated by PCR mutagenesis using KOD hot start DNA polymerase (Novagen). The MNV-3 M1 mutant was generated by inserting a stop codon ...
-
bioRxiv - Microbiology 2019Quote: ... All cell lines were regularly tested for mycoplasma contaminations using LookOut® Mycoplasma PCR Detection Kit (Sigma-Aldrich, MP0035-1KT). Additionally ChIP-seq reads from input samples were aligned to mycoplasma reference sequences to exclude contamination.
-
bioRxiv - Systems Biology 2020Quote: ... respectively by transformation with a 1890 bp PCR amplified dig1Δ0::hyg allele and selection on hygromycin B (200 μg/ml) (Sigma Aldrich,) medium ...
-
bioRxiv - Biochemistry 2020Quote: ... encoding the cpeB gene from Prochlorococcus marinus MED4 was PCR amplified with primers (Table 4) encompassing selected recognition sites (EcoRI, HindIII) for cloning into pCOLADuet (Novagen).
-
bioRxiv - Molecular Biology 2019Quote: ... for each pSmChE were amplified from each full-length template by PCR and cloned into the pET41a expression vector (Novagen) such that the N-terminal GST tag was removed ...
-
Significant control of Zika infection in macaques depends on the elapsing time after dengue exposurebioRxiv - Immunology 2019Quote: ... Real-time RT-PCR (TaqMan) assay-specific primers and probes for ZIKV were designed by Sigma-Aldrich (St Louis, MO) following the protocol developed by the Molecular Diagnostics and Research Laboratory Centers for Disease Control and Prevention (CDC) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR fragments were analyzed using Agarose Gel Electrophoresis and purified from Gel using the GenElute Gel Extraction Kit (Sigma, NA1111) or MinElute Gel Extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared using 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, Gillingham, UK), 0.4 µL ROX High ...
-
bioRxiv - Immunology 2020Quote: ... Each region of the protein was amplified via PCR and fragments were combined using Gibson assembly into pET28 vector (Millipore) for expression in E ...
-
bioRxiv - Immunology 2020Quote: ... The specificity of amplification was verified by size visualization of the PCR product (Table 1) after electrophoresis on a 1.8% agarose gel (Sigma-Aldrich) in 1% TBE (Tris-borate-EDTA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... plasmid DNA was linearized with XhoI or HindIII and purified using Montage PCR filter units and Micropure EZ column (Millipore). For pronuclear injection of FVB embryos ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each cDNA was PCR-amplified and ligated between the SacI and KpnI sites of pRSF_Duet1 (Millipore Sigma, Burlington, MA, USA) with an N-terminal 6x histidine tag and a C-terminal Strep-II tag.
-
bioRxiv - Plant Biology 2022Quote: ... Expression levels were quantified by quantitative PCR in triplicate reactions from three biological replications using SYBR Green JumpStartTaq ReadyMix (SIGMA) with the standard run conditions for the ABI 7900 HT ...
-
bioRxiv - Molecular Biology 2023Quote: 10% of the RT reaction was used as the template in 25 μl PCR reactions containing 1.25U of JumpStart Taq Polymerase (Sigma D9307), 1×PCR buffer (Sigma P2192) ...
-
bioRxiv - Plant Biology 2022Quote: ... The 981-bp PCR product was digested with BamHI and HindIII and cloned into BamHI-HindIII-digested pETDuet-1 vector (Novagen), giving pMS977 ...
-
bioRxiv - Neuroscience 2022Quote: Mycoplasma testing was performed monthly for all the lines included in this study at any differentiation stage (LookOut Mycoplasma PCR Detection Kit, Sigma). All cells used in this study were consistently negative.
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μg of genomic DNA were used for PCR reaction with primer 495 and 489 (Supplemental Table 1) with Red taq (Sigma) with the following PCR condition ...
-
bioRxiv - Molecular Biology 2022Quote: ... yejASm lacking the fragment encoding the first 30 amino acids (signal peptide) was PCR-amplified from Sm1021 genomic DNA and cloned into a pET29b(+) vector (Novagen) generating a C-terminal 6His-tag ...
-
bioRxiv - Microbiology 2022Quote: ... Cultures were confirmed negative for mycoplasma approximately monthly using a LookOut Mycoplasma PCR detection kit (Sigma Aldrich, St Louis, MO).
-
bioRxiv - Microbiology 2022Quote: All cell culture experiments were regularly tested for mycoplasma contamination using LOOKOUT® Mycoplasma PCR Detection Kit (Sigma-Aldrich, USA) for mesothelioma cell culture and PCR Mycoplasma Test Kit I/C (Promokine ...
-
bioRxiv - Microbiology 2024Quote: ... to introduce a KpnI site without changing the amino acid sequence by PCR from pTagRFP-N1 65 and cloning it into pFlag-CMV2 (Sigma). pFlag-TagRFP-KanS ...
-
bioRxiv - Microbiology 2022Quote: ... NSm and the entire pcDNA3.1 vector encoding Gn with an N-terminal SS plus HA tag were amplified by PCR using KOD Hot Start DNA polymerase (Novagen), mixed and then concatenated using the NEBuilder HiFi assembly kit according to the manufacturer’s instructions to yield pSnH-OROV-M ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were performed in 25μL volumes in a 0.2mL tube containing 12.5μL REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich R2523), 10.5μL ddH2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single ICMs were individually transferred into PCR tubes containing 5 μL of lysis buffer (0.1 μL Triton X-100 (10% v/v in water, Sigma-Aldrich); 1.2 μL dNTP mix (25 mM each ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...