Labshake search
Citations for Millipore Sigma :
3901 - 3950 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... followed by a permeabilization step with 3% Triton™ X-100 (Sigma Aldrich) for an additional 5 min in the blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: The magnetic extraction set-up consisted of three 3 mL cuvettes (Sigma Aldrich) and a neodymium magnet (60×10×3 mm ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.2 μL of MgCl2 (25 mM, Sigma-Aldrich, #M8266; CAS 7786-30-3), 2 μL of genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... 3 dpf MD zebrafish were soaked in 25 μg/mL lipoteichoic acid (Sigma) or 25 μg/mL peptidoglycan (Sigma).
-
bioRxiv - Physiology 2020Quote: ... blocked with PBST containing 3 % normal goat serum (blockPBST; Sigma-Aldrich, MO, USA) for 1 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Aggregates were incubated with primary antibodies in blocking buffer (3% BSA (Sigma, A9647) and 0.3% Triton X-100 in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Biophysics 2020Quote: ... the larvae were anesthetized with tricaine (3-amino benzoic acidethylester, Sigma Aldrich, MO) and immobilized in 1% low-melting-point agarose inside FEP (Fluorinated Ethylene Propylene ...
-
bioRxiv - Microbiology 2021Quote: ... we pumped ∼3-6 liters of fluid through 0.22 µm Sterivex filters (Millipore) on the seafloor ...
-
bioRxiv - Bioengineering 2021Quote: ... 48.42 mg of N-(3-Dimethylaminopropyl)-N’-ehtylcarbodiimide hydrochloride (EDC-HCl) (Sigma-Aldrich) were added to the solution along with 27.40 mg of N-hydroxy-sulfosuccinimide (sulfo-NHS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 ml of fresh medium containing 0.75% carboxy-methyl-cellulose (Sigma-Aldrich) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... Cultures were maintained in the presence of neurotrophin-3 (50ng/ml, Sigma-Aldrich) and brain derived neurotrophic factor (50 ng/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were individually embedded in 3% agarose (Sigma Aldrich, St. Louis, USA), dehydrated and embedded in epoxy resin (44611-4 ...
-
bioRxiv - Developmental Biology 2020Quote: T7-promoter sequence- and 3’ overhang-containing DNA oligos were synthesized (Sigma-Aldrich), annealed to a common tracer oligo (AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The completed plasmid was transformed into Rosetta BL21 cells (Millipore Sigma, 70954-3). A starter culture of 5 ml of Rosetta BL21 cells containing the completed plasmid were grown overnight at 37°C in LB with Kanamycin ...
-
bioRxiv - Biochemistry 2020Quote: ... then visualized using 400 μL 8 mg/mL 3-amino-9-ethylcarbazole (Sigma) in 10 mL 50 mM sodium acetate (Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... permeabilised for 3 minutes at room temperature with 0.1 % Triton-X-100 (Sigma) in DPBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 3% (w/w) H2O2 stock (Sigma-Aldrich, Saint Louis, MO, Catalog #323381-25ML) was stored in 100 μL aliquots at −20°C.
-
bioRxiv - Cancer Biology 2021Quote: ... concentrated with an Amicon Ultra Centrifugal Filter Units (3 kDa cutoff, Millipore UFC900324) and buffer exchanged with 50 mM Ammonium bicarbonate (Sigma A6141) ...
-
bioRxiv - Cell Biology 2020Quote: ... This basal medium was supplemented with 2i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat ...
-
bioRxiv - Biochemistry 2021Quote: ... Flow cells were regenerated using 3 M GuHCl (Sigma Aldrich, Saint Louis USA). Sensorgrams were analysed ...
-
bioRxiv - Biochemistry 2021Quote: ... Serum free medium was concentrated using 3 kDa cut-off filters (Sigma-Aldrich). Next ...
-
bioRxiv - Biochemistry 2021Quote: ... pre-incubated for 3-7 h with rabbit anti-FLAG antibody (Sigma-Aldrich) at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Later the harvested brains were incubated in 3 mL of 99.5% formamide (Sigma) for 48 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... media was spin-concentrated using a 3 kDa MWCO centrifugal unit (Millipore-Sigma) and the concentrated conditioned media was analyzed by Luminex.
-
bioRxiv - Cell Biology 2021Quote: ... media was spin-concentrated using a 3 kDa MWCO centrifugal unit (Millipore-Sigma) and the concentrated conditioned media was analyzed by Luminex.
-
bioRxiv - Developmental Biology 2021Quote: ... Differentiation media was supplemented with 2ng/ml BMP4 and 3 µmol Thiazovivin (Millipore). embryoid bodies were cultured in 6cm dishes (USA Scientific ...
-
bioRxiv - Pathology 2021Quote: ... with the addition of blocking endogenous peroxidase activity with 3% H2O2 (Sigma Aldrich) in ddH2O after epitope retrieval ...
-
bioRxiv - Biochemistry 2021Quote: ... The samples were then washed using water and 3-kDa filters (Millipore Sigma) to remove any guanidine hydrochloride ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were stained during 3 hours with 0.5% w/v Victoria Blue (Sigma) in acid alcohol and after staining embryos were washed in acid alcohol until the embryos were white ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were mounted on the 3% Methyl cellulose (Sigma Aldrich, cat no. M0512) and imaged on an Axioplan Microscope (Zeiss ...
-
bioRxiv - Cell Biology 2020Quote: ... cultures were supplemented with auxin (Indole-3-acetic acid sodium salt, Sigma I5948) to final concentrations of 500 µM ...
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted from 3×106 HeLa cells using TRIzol (Sigma, T9424). Prior to submission for high-throughput sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... we fixed 100mL of mid-exponential LSUCC0096 culture with 3% glutaraldehyde (Sigma Aldrich) and stored at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... Depletions were induced by 3 days exposure to 2.5 μg/ml doxycycline (Sigma) as described (19) ...
-
bioRxiv - Immunology 2021Quote: ... 100 ml/well of 3 mg/ml paranitrophenyl-phosphate disodium hexahydrate (Sigma Aldrich) in 1 M diethanolamine buffer pH 9.8 and plates were incubated at room temperature in the dark for 45min ...
-
bioRxiv - Genomics 2020Quote: ... Samples were washed with TLE 3 times in 30KDa amicon columns (MilliPore # UFC5030BK). Both SisterC and Hi-C libraries were then enriched for biotin-containing fragments by pull down with MyOne Streptavidin C1 beads (Life Tech #65-001) ...
-
bioRxiv - Neuroscience 2020Quote: ... washed 3 times in 0.3% PBST (0.3% Triton-X100 in PBS, Sigma-Aldrich), blocked in 5% goat serum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... and 3 weeks later with the same material in incomplete Freund’s adjuvant (Sigma). Mice were boosted both intravenously and intraperitoneally 2 weeks later with 20 μg of the same antigen in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
bioRxiv - Immunology 2021Quote: ... permeabilized and blocked with PBS containing 3% bovine serum albumin Fraction V (Sigma), 0.2M Triton X-100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed 3 times in M9 and frozen at −80°C in Trizol (Sigma) before RNA preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed 3 times with 1X PBS and mounted with Fluoroshield with DAPI (Sigma). Images were acquired with a Nikon Perfect Focus Eclipse Ti live-cell fluorescence microscope ...
-
bioRxiv - Bioengineering 2020Quote: ... MMP-3 was activated in 0.1 mM P-Aminophenylmercuric acid (#164610, Milipore Sigma) at 37 °C for 24 hours ...
-
bioRxiv - Genomics 2020Quote: ... and subsequently hybridized with a biotin-labeled (TTAGGG)3 probe synthesized by Sigma. The North2South® Chemiluminescent Hybridization and Detection Kit (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... acidified to a final concentration of 0.5% trifluoroacetic acid (pH < 3, Sigma, AAA1219822) and desalted by reversed phase C18 solid phase extraction (SPE ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated in 3 mg/mL RU486 (in 80 % ethanol, M8046, Sigma Aldrich) for 10 min to activate the geneswitch ...
-
bioRxiv - Neuroscience 2020Quote: ... prior to 3 final PBS washes and mounting in FluorSave reagent (Millipore Sigma).