Labshake search
Citations for Millipore Sigma :
3851 - 3900 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... followed by 3 days on food containing 400 µM all-trans retinal (Sigma). The following genotypes were assayed ...
-
bioRxiv - Neuroscience 2020Quote: ... washed 3 times in PBS and resuspended in PBS + Protease Inhibitor (PI, Sigma). Worm ‘popcorn’ was prepared by dripping worm solution into liquid nitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The cleaned media were concentrated with a 3 kDa cutoff ultrafilter (Millipore, UFC900324) to 200-300 μl ...
-
bioRxiv - Biophysics 2020Quote: ... passaged every 3-4 days by trypsinization with trypsin-EDTA solution (Sigma-Aldrich) and moved to the corresponding Petri dishes ...
-
bioRxiv - Biophysics 2021Quote: ... concentrated to ~3 mg/ml with a 10 kDa cut-off concentrator (Millipore), flash-frozen by liquid nitrogen and stored at −80 °C until use.
-
bioRxiv - Cell Biology 2021Quote: ... animals were anaesthetized with Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich, Cat#: A5040). At the end of the experimental procedures ...
-
bioRxiv - Physiology 2021Quote: ... Elution of the immunoprecipitates was performed with 3× FLAG peptide (F4799, Sigma-Aldrich). The immunoprecipitation procedure was validated by western blotting using FLAG and Fam64a antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... coli ClpAΔC9 fused to the 3’-end of His6SumoFLAG cloned into pET23b (Novagen). ClpA was overexpressed in T7Express (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: ... A standard solution of poly(3-hydroxy-butyrate) (average Mn ~500,000, Sigma Aldrich) was prepared using the same method ...
-
bioRxiv - Bioengineering 2021Quote: ... They were then blocked with 3% bovine serum albumin (A9418-500G, Sigma Aldrich) in PBS for 2 hours at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... SC –leu-trp plates and SC –leu-trp-his + 10mM 3-aminotriazole (Sigma) plates ...
-
bioRxiv - Cell Biology 2021Quote: ... Each sample was then blocked and permeabilized in 3% Bovine Serum Albumin (Sigma) and 0.1% Triton X-100 (American Bioanalytical) ...
-
bioRxiv - Plant Biology 2021Quote: ... Western blotting was performed using anti S-tag (Cat no. 71549-3, Novagen) and anti His-tag antibody to detect protein-protein interaction.
-
bioRxiv - Plant Biology 2020Quote: ... with 3 kDa molecular weight cut off (Amicon® Ultra, Merck Millipore Ltd.) to remove high molecular weight conjugates of IAA ...
-
bioRxiv - Microbiology 2020Quote: ... All primers are listed in Table 3 and were obtained from Sigma-Aldrich. PCR reactions were visualized and analyzed by gel electrophoresis on 1 % (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... 28 mm clean coverslips were treated with 0.5% APMS-3-aminopropyltrimethoxysilane (APMS) (Sigma) in water for 15-20 min followed by 4-5 washes with distilled water ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed and then blocked with 3% bovine serum albumin (BSA; Millipore) in DPBS for one hour at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... embryos were anesthetized with 500 μM tricaine (Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich), mounted in 3% methyl-cellulose on a glass slide and imaged on a Nikon SMZ25 stereomicroscope.
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 cells were preincubated with the indicated amounts of ATN-161 (Sigma) for two hours and infected with SARS-CoV-2 Viral isolate BetaCoV/France/IDF0372/2020 (MOI 0.05 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-PC-3 and GP-9A cells were cultured in RPMI-1640 (Sigma). Capan-2 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... were treated with 500μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) to induce degradation of the desired AID-tagged target protein ...
-
bioRxiv - Cell Biology 2020Quote: ... Sodium orthovanadate and Phosphatase Inhibitor Cocktail 3 were all obtained from Sigma-Aldrich. RPMI 1640 ...
-
bioRxiv - Biophysics 2020Quote: ... 4.5% acetic acid and 2.5% 3-(triethoxysilyl)-propylamine (EMD Millipore Corp., Billerica, MA), rinsed with methanol and water and finally dried under a stream of nitrogen (63) ...
-
bioRxiv - Biophysics 2020Quote: We performed Arp2/3 complex and myosin-II inhibition experiments using ck666 (Sigma) and blebbistatin (Abcam) ...
-
bioRxiv - Cancer Biology 2021Quote: ... noggin and EGF and containing 10 µM nutlin-3 (Sigma #675576-98-4).
-
bioRxiv - Developmental Biology 2022Quote: 3 and 5dpf embryos were fixed and stained using Sudan Black (Sigma-Aldrich) (le Guyader et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 % glucose (FUJIFILM Wako) and 0.1 mg/mL each of adenine (Sigma-Aldrich), uracil (Sigma -Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We dissolved analytical grade imidacloprid (CAS Number: 138261-41-3, Sigma Aldrich, Sweden) in a solution of 10% raw sugar in 0.01M Phosphate Buffer to achieve logarithmically spaced concentrations of imidacloprid ranging from µg/L to 2 g/L (Table 1 ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were rinsed 3 times in PBS and then mounted with Fluoshield (Sigma). Whole brain images were obtained on an Olympus virtual slide microscopy VS120-L100-W with a 10x objective (Olympus Canada Inc. ...
-
bioRxiv - Physiology 2022Quote: Auxin plates were prepared by adding auxin indole-3-acetic acid (Sigma-Aldrich) from a 400 mM stock solution in ethanol into NGM at the final concentration of 1 mM (Zhang et al ...
-
bioRxiv - Neuroscience 2020Quote: ... prior to 3 final PBS washes and mounting in FluorSave reagent (Millipore Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... 40 µM (final concentration) of 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU, Sigma-Aldrich) and 1mM (final concentration ...
-
bioRxiv - Biophysics 2020Quote: ... 500 µL ethanol and 12 µL (3-Aminopropyl)triethoxysilane (APTES, 99%, Sigma-Aldrich) to a vial 38,39 ...
-
bioRxiv - Neuroscience 2021Quote: ... they were washed 3 times in PBS and mounted in Mowiol (Sigma-Aldrich). Images were collected using a confocal microscope (Olympus FV1200 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The eluent was placed in Amicon ultra centrifugal filters (3 kDa, Millipore, USA) with 200 μL H2O ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... The odorants used were 0.1% 3-octanol and 0.1% 4-methylcyclohexanol (Sigma Aldrich), controlled via three-way solenoids (Lee Company) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase, Sigma-Aldrich) from a mouse brain cDNA library using the forward primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... samples were washed 3× in PBS and 150 nm gold nanoparticles (Sigma-Aldrich) were added for 15 min to act as fiducial markers for drift correction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... primary antibodies diluted in 3% (w/v) BSA (Bovine serum albumin, Sigma, A4503) in PBS-T was added on slides and incubated either for 2 hours at room temperature or at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated using a 3 kDa cutoff spin concentrator (Millipore Sigma UFC9003) to a volume of 2 mL ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated in secondary antibodies (Supplemental Table 3) and DAPI (10g/ml, Sigma,) diluted in 10% NDS in 0.1% Triton-PBS for 90 minutes at r.t ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 ml of selective EZ containing 0.85 g/l Pluronic F-127 (Sigma) were inoculated with the overnight preculture in a 1:100 ratio and grown for 3-4 h at 37° C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... followed by plating on SP4 agar containing 3 µg/mL of puromycin (Sigma). Colonies appeared after 3 to 4 days at 37 °C.
-
bioRxiv - Evolutionary Biology 2020Quote: ... cells were treated with 3% H2O2 (v/v in 1xPBS; Millipore Sigma, Canada) to eliminate endogenous peroxidase activity and dehydrated overnight in 70% ethanol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells were washed 3 times and maintained in XF-DMEM (Sigma-Aldrich) supplemented with 1 mM sodium pyruvate and 17.5 mM glucose ...