Labshake search
Citations for Millipore Sigma :
3751 - 3800 of 4383 citations for MOA SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Levels of nitrate and nitrite in plasma obtained from human and mice were estimated by a Griess colorimetric assay kit (Sigma chemicals) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The precipitated proteins were used for determination of protein content using a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich, Taufkirchen, Germany).
-
bioRxiv - Microbiology 2021Quote: ... for pathological examination.Paraffin-embedded lung tissue sections were also stained for the presence of fungal structures using the Silver Stain Kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total carbohydrate was determined by the Dubois phenol-sulfuric acid method (76) adapted to a 96-well plate assay with the Total Carbohydrate Assay Kit (MAK 104, Sigma-Aldrich), using D-glucose as the standard and absorbance read at a wavelength of 490 nm ...
-
bioRxiv - Neuroscience 2020Quote: ... avidin biotin was added to attach peroxidase (ABC kit; Vector, PK-4000) and sections reacted with DAB and urea peroxidase (Sigmafast, D4293, Sigma Aldrich) until the reaction product was clearly visible.
-
bioRxiv - Microbiology 2021Quote: ... DNA was then extracted from 2 mL of cell culture using a GenElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich, USA). DNA samples were subjected to an initial quality check using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then biotinylated by click-it reaction according to the manufacturer protocol (Click-iT® Nascent RNA Capture Kit; Life technology) and precipitated with EtOH (Sigma) and Na-acetate (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Genomics 2020Quote: Nuclei were isolated from ~100mg of frozen frontal cortex brain tissue from Brodmann area 9 at the HIHG using the Nuclei Isolation Kit: Nuclei EZ Prep (Sigma, #NUC101). All tissues were homogenized in ice-cold EZ Lysis buffer with a glass-on-glass dounce homogenizer ...
-
bioRxiv - Microbiology 2021Quote: Cell viability and cytotoxicity of antibiotics and peptides were determined against human corneal epithelial cells (HCE-2, CRL-11135, ATCC, Manassas, Virginia, USA) using cell-counting-kit-8 (CCK-8) assay (Sigma Aldrich, Merck Life Science UK Limited ...
-
bioRxiv - Microbiology 2021Quote: ... We then used these primers (TTCGTCGTGAGACAGAGCGG, AGGCCATTGACGGATGGTTTGTAC) to amplify DNA from the two positive mosquitoes using the Expand™ Long Range dNTPack kit (Sigma) using the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: Genomic DNA from all the endpoint populations was extracted using GenElute Bacterial Genomic DNA Kit (NA2120; Sigma-Aldrich, St. Louis, MO) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Protein concentration was determined by the bicinchoninic acid protein assay kit (BCA-Pierce, USA) using bovine serum albumin (BSA, Sigma-Aldrich) as standard.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was removed and the cell pellet was resuspended in 500 μL Diluent C containing 2 μL PKH67 dye (PKH67 Green Fluorescent Cell Linker Kit, Sigma-Aldrich), incubated for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... samples were centrifuged at 10,000g for 5 min and the Acetyl-CoA measurement was performed in a 96-well plate using the Acetyl-Coenzyme A Assay Kit (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Lactate dehydrogenase (LDH)-based cytotoxicity levels were determined by evaluation of LDH release into the cell culture supernatants using Lactate Dehydrogenase Activity Assay kit (MAK066, Sigma-Aldrich). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... Methylated mRNA was eluted by free m6A from the beads and purified with the GenElute™ mRNA Miniprep Kit (MRN70, Sigma). One tenth of the fragmented RNA was saved as an input control for standardization ...
-
bioRxiv - Biochemistry 2021Quote: ... after 4 hours cells were fixed in 3.7% paraformaldehyde/30 mM sucrose for 10 min and processed either for the is-PLA experiment by using the Duolink PLA kit (DUO92007, Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: MCDK cell viability following exposure to GO-AgNP supernatants or vehicle was assessed using a Cytotoxicity Detection Kit (Millipore Sigma #11644793001). Prior to testing ...
-
bioRxiv - Microbiology 2021Quote: ... was prepared from an overnight culture in THB-Y broth and high-molecular-weight genomic DNA was isolated using the Sigma Genelute kit (Sigma Aldrich) according to the manufacturer′s instructions ...
-
bioRxiv - Immunology 2021Quote: ... we extracted genomic DNA from mouse tails and performed PCR with REDExtract-N-Amp™ Tissue PCR Kit following the manufacturer’s instructions (Sigma-Aldrich) and analyzed samples on agarose gel ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed in 70% ethanol for 1 h and stained for 10 min with an ALP staining solution (BCIP/NBT alkaline phosphatase kit, Sigma-Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were lysed by bead-beating in the presence of buffer RA-1 (NucleoSpin RNA isolation kit, Mackery-Nagel) and β-mercaptoethanol (Sigma). RNA isolation and purification was continued according to the protocol supplied by the manufacturer (Nucleospin RNA isolation kit ...
-
bioRxiv - Microbiology 2022Quote: ... Isopropanol was mixed with the aqueous phase and RNA was isolated as per the GenElute Mammalian Total RNA Miniprep kit (RTN350, Millipore Sigma) protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... catalysis (ChE activity) were determined either as previously described (Hagstrom et al. 2017) or using an Acetylcholinesterase Activity Assay Kit (Sigma-Aldrich). Absorbance was read at 412 nm every minute for 10 minutes using a VersaMax (Molecular Devices ...
-
bioRxiv - Pathology 2022Quote: ... Pf2-HA_OE and pf2-HA_KO ChIP and input control samples) was recovered from Proteinase K treated samples using the GenElute PCR purification kit (Sigma-Aldrich).
-
bioRxiv - Genomics 2022Quote: ... The next day the DNA was extracted from 500 µl of culture using the GeneElute bacterial genomic DNA kit (Sigma-Aldrich). gDNA was quantified ...
-
bioRxiv - Genetics 2022Quote: ... The external ammonium concentration was estimated as a function of time for 3 hours using the below-mentioned principle (Ammonia Assay Kit - Sigma-Aldrich). At each time point ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secretion of the following cytokines was quantified with the MILLIPLEX® Human CD8+ T Cell Magnetic Bead Panel Premixed 17 Plex - Immunology Multiplex Assay kit (EMD-Millipore): IL-6 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Yolk sacs from each of the dissected embryos were collected and genomic DNA preparation was done using Extract-N-Amp tissue PCR kit (Sigma-XNAT2). Placenta tissues were collected in RLT buffer and RNA was extracted using RNAeasy Mini Kit (Qiagen – 74104) ...
-
bioRxiv - Genomics 2019Quote: Aphid samples were ground to a fine powder and total RNA was extracted using a plant RNA extraction kit (Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic DNA was isolated from expanded clones after the second FACS sorting step using the GenElute mammalian genomic DNA miniprep kit (Sigma-Aldrich) and amplified in a PCR reaction using primers P1/P5 (Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The supernatant was kept for proteomics analysis and electrophoresis followed by silver staining after addition of fresh 6x sample buffer (ProteoSilver Silver Stain Kit, Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: Ribonucleoprotein complex immunoprecipitation (RIP) was performed using the EZ-Magna RIP RNA-binding protein Immunoprecipitation Kit (Merck Millipore Billerica, Massachusetts, USA). Huh7.5-SGR cells were seeded in Petri dishes at 106 cells/dish for 24 h prior to transfection with pKSRP-HA plasmids ...
-
bioRxiv - Developmental Biology 2019Quote: ... H9 hESCs were nucleofected using the Lonza P3 Primary Cell 4D-Nucleofector X Kit and monoclonal colonies were selected for 7-10 days with 1 μg/ml of puromycin (Sigma-Aldrich). Tetracycline hydrochloride (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: RNA isolation was carried out with 2 g of soil using RNA PowerSoil Total RNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA. USA) with phenol chloroform isoamyl alcohol 25:24:1 (Sigma-Aldrich) following the instructions of the manufacturer and resulting in 100 μL of RNA solution ...
-
bioRxiv - Genomics 2019Quote: ... with 2 mL of ice-cold EZ-Prep lysis buffer from the Nuclei EZ-prep Isolation Kit (Sigma, Cat #NUC-101). The tissue was dounced 25 times with Pestle A ...
-
bioRxiv - Cell Biology 2019Quote: ... the ligation experiment was performed according to the manufacturer’s instructions using the Duolink® In Situ Orange Starter Kit Goat/Rabbit (Sigma-Aldrich). Briefly ...
-
bioRxiv - Systems Biology 2019Quote: ... Cells were then lysed by using lysis buffer and ATP activity was analyzed by using the Adenosine 5’-triphosphate (ATP) Bioluminescent Assay Kit (Sigma-Aldrich) according to manufacturer instructions ...
-
bioRxiv - Physiology 2019Quote: ... TG content of cells before and at the end of adipogenic differentiation was performed as previously described (Dirat et al, 2011) using commercial kit (Sigma-F6428).
-
bioRxiv - Developmental Biology 2019Quote: Genomic DNA samples were prepared using tail tissues or embryonic tissues from the mice using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). Genotyping was done using REDExtract-N-Amp PCR ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The template for the bulk DNA probe was generated using isolated nuclei (Galbraith et al., 2011) and GenElute™ Plant Genomic DNA Miniprep Kit (Sigma).
-
bioRxiv - Genomics 2019Quote: ... Individual colonies were cultured overnight before isolation of plasmid DNA using the GenElute™ miniprep kit (Sigma-Aldrich, Catalogue No. PLN350). Purified plasmids were Sanger sequenced to confirm successful cloning ...
-
bioRxiv - Microbiology 2019Quote: ... These clones were grown separately overnight in lysogeny broth (LB) medium and used for plasmid extraction with GenElute Plasmid Miniprep Kit (Sigma-Aldrich). PCR amplifications ...
-
bioRxiv - Immunology 2019Quote: ... Osteoclast generation was verified directly by phase contrast microscopy or after staining for Tartrate-Resistant Acid Phosphatase (TRAP) (Leukocyte Acid Phosphatase kit, Sigma-Aldrich). Human TNFα and CCL2 in M-MØ culture supernatants were measured using commercially available ELISA (BD Biosciences).
-
bioRxiv - Immunology 2019Quote: ... Neutrophil viability was measured using Muse Annexin V and Dead Cell Assay Kit on a Muse Cell Analyzer mini-flow cytometer (EMD Millipore).
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from the si-NC and si-Dnmt3aos-transfected M(IL-4) macrophage cells and was then treated with bisulfite using the Imprint DNA Modification Kit (Sigma-Aldrich). Bisulfite sequencing and pyrosequencing were conducted by Shanghai Sangon Biotech Corporation ...
-
bioRxiv - Genetics 2020Quote: ... the immune peroxidase was detected using a Vectastain ELITE ABC kit (Vector) and visualized with a solution of diaminobenzidine (Sigma Aldrich) in the presence of 0.01% H2O2 ...
-
bioRxiv - Immunology 2019Quote: Lactate concentration in the extracellular medium of T cells cultured under Th17-polarizing conditions for 96h was performed using the Lactate Assay kit from Sigma-Aldrich according to manufacturer’s instructions.