Labshake search
Citations for Millipore Sigma :
301 - 350 of 1005 citations for PCR strip since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Primers utilized to produce PCR fragments were purchased from Sigma-Aldrich.
-
bioRxiv - Microbiology 2023Quote: All PCR primers used in this study were synthesized by Sigma and are indicated Supplementary Table S1.
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification was performed using KOD Hotstart polymerase kit (EMD Millipore) and primers flanking the gRNA target sites (Table 2) ...
-
bioRxiv - Genomics 2023Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen) according to (46) ...
-
bioRxiv - Cancer Biology 2023Quote: Custom primers for real-time PCR were purchased from Sigma-Aldrich, Germany (GAPDH ...
-
bioRxiv - Cancer Biology 2023Quote: The PCR product was then run on 2% agarose (Sigma, #A4718) gel containing Ethidium Bromide (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... contamination (Lookout Mycoplasma PCR detection kit; Sigma-Aldrich, St. Louis, MO).
-
bioRxiv - Genomics 2023Quote: ... PCR was performed using JumpStart Taq DNA Polymerase (Sigma-Aldrich, D9307) with the following PCR conditions ...
-
bioRxiv - Microbiology 2024Quote: ... We then used PCR with KOD Polymerase 2x Mastermix (Millipore Sigma) to append a T7 promoter sequence ...
-
bioRxiv - Microbiology 2024Quote: ... PCR reactions were performed with KOD Polymerase (Novagen, San Diego, CA), and products were cleaned using the ZymoResearch Clean and Concentrator kit (Irvine ...
-
bioRxiv - Microbiology 2023Quote: ... then purified using GenElute PCR Clean-Up Kit (Sigma, SKU NA1020), and KAPA Pure Beads (Roche-07983298001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Inserts were acquired by PCR using KOD Hotstart Mastermix from NovaGen and purified from gel using Monarch DNA Gel Extraction kit from NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplifications were performed using KOD Hot Start DNA polymerase (Merck Millipore). All restriction enzymes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Library PCRs were supplemented with 2x SYBR dye (Sigma – catalogue no. S9430) so that amplification could be monitored by quantitative PCR on a Roche lightcycler 480 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Library PCRs were supplemented with 2x SYBR dye (Sigma – catalogue no. S9430) so that amplification could be monitored by quantitative PCR on a Roche lightcycler 480 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... For the PCRs we used a standard Taq DNA polymerase (Sigma Aldrich) and limited the elongation time to 90 seconds so that an homozygous insertion of the 5-kb ONSEN TE or the T-DNA would prevent the formation of a PCR-product ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sanger sequencing of the PCR products was performed using commercial service (Sigma). The sequencing traces were examined and the fish carrying A to G mutation were selected ...
-
bioRxiv - Neuroscience 2021Quote: ... Overlapping PCR primers encoding the gRNA sequences were ordered from Sigma-Aldrich and Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 10 μl of RedExtract-N-ampl PCR reaction mix (Sigma-Aldrich), 0.8 μl of each primer (10 M) ...
-
bioRxiv - Cell Biology 2022Quote: ... All oligonucleotides used in PCR and cloning were procured from Sigma-Aldrich. Phusion® polymerase ...
-
bioRxiv - Microbiology 2019Quote: ... gel-purified PCR products were ligated into the pET15b expression vector (Novagen). Expression in E ...
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... and inserting the H6-SpeI-mScarlet PCR product into pET28a (Novagen #69864) using NcoI and BamHI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was carried out using SYBR Green JumpStart Taq ReadyMix (Sigma) using the appropriate primers (Figure 2-source data 1) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... was purified using the GeneElute PCR Clean-Up Kit (Sigma-Aldrich, USA), then labeled with biotin-16-dUTP (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed with the KOD Hot-start 2× master mix (Novagen), and cloning was performed using Gibson Assembly 2× Master Mix (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the region encoding GFP1–10 was PCR amplified (KOD polymerase, EMD Millipore) from pSJ1256 using primers containing the PacI and AscI (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were inserted into p3×FLAG-CMV-10 vector (Sigma-Aldrich) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR products were separated by gel electrophoresis in 1% agarose (Sigma). Gene-Ruler 100 bp DNA ladder (ThermoScientific ...
-
bioRxiv - Microbiology 2022Quote: ... Mice were genotyped using Extract-N-Amp Tissue PCR Kit (Sigma Aldrich) according to manufacturers’ instructions with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Millipore 71842-3) using primers KL207/KL200 for the sfgfp gene and primers BAC338F/BAC805R for the 16S rRNA gene48.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were analysed by electrophoresis on 1% agarose gel (Sigma-Aldrich), containing SafeView (ABM) ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was verified by PCR (REDTaq® ReadyMix™ # R4775, Sigma Aldrich). The primers ...
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen®), following standard protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Samples for qPCR and qRT-PCR were homogenized in TRiZOL (Sigma Aldrich) reagent and further processed for nucleic acid extractions using manufacturer’s protocols.
-
bioRxiv - Evolutionary Biology 2022Quote: ... we purified both libraries using the GenElute PCR Clean-Up Kit (Sigma) to remove short library fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... k-mer sequences were assembled using PCR from oligos purchased from Sigma.
-
bioRxiv - Biophysics 2019Quote: ... coli MG1655 genome by PCR into pET15b (Merck Millipore, Billerica, MA, USA) by Gibson assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... All oligonucleotides used in PCR and cloning were procured from Sigma-Aldrich. XT-20 high fidelity polymerase was used in all cloning protocols and purchased from GeNei Pvt ...
-
bioRxiv - Developmental Biology 2020Quote: ... we prepared this mixture for PCR: 10µL of Taq polymerase (Sigma P0982), 1µL of the premade sex primer stock ...
-
bioRxiv - Microbiology 2020Quote: ... Vectors were generated by inverse PCR using KOD Hot-start polymerase (Novagen) or by Gibson assembly in a homemade reaction master mix (100 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A PCR with REDTaq® DNA polymerase (Sigma-Aldrich, Saint Louis, Missouri) was performed and the length of the amplified products was checked by 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:10 mixed with 1x PCR buffer (Sigma Aldrich), 1.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digested PCR product was cloned into a pET-52b(+) plasmid (Novagen) in frame with an N-terminal Strep-tag II obtaining the B35SSB expression vector pET52b::B35SSB ...
-
bioRxiv - Genomics 2019Quote: ... with the SYBR Green JumpStart Taq ReadyMix for Quantitative PCR (Sigma Aldrich). Using the Primer3 software70 ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... Mice were genotyped using Extract-N-Amp Tissue PCR Kit (Sigma Aldrich) according to manufacturer instructions with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... along with mycoplasma testing using the LookOut Mycoplasma PCR Detection Kit (Sigma).
-
bioRxiv - Immunology 2021Quote: ... and fluorescence imaging and LookOut® Mycoplasma PCR detection kit (Sigma-Aldrich). Primary antibodies used for immunohistochemistry included ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using KOD Xtreme™ Hot Start DNA Polymerase (Millipore, 71975) and the primers TCGATGCTCTGTTTCGAATG and CTTCTTCCCCCTTGCCTTAC flanking the targeted deletion site ...
-
bioRxiv - Genetics 2021Quote: ... The PCR master-mix used was: Taq polymerase (Novagen NovaTaq 0.04U/μL), primers (0.5 μM each) ...