Labshake search
Citations for Millipore Sigma :
101 - 150 of 1005 citations for PCR strip since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 1X PCR buffer containing MgCl2 (Sigma), 250 µM dNTP (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product and pET-30b (+) (Novagen) were digested with XbaI and XhoI restriction enzymes ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR primers (Sigma Aldrich, Taufkirchen, Germany) and probes (Roche Universal Probe Library ...
-
bioRxiv - Immunology 2023Quote: ... and RT-PCR amplification data (Sigma). Samples were pooled and normalized to 10nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reaction mixture contained 2.5 units Taq polymerase and 1 x PCR buffer (D1806, Sigma-Aldrich), 0.25 mM dNTP mix and 0.5 μM of each of the primers ...
-
bioRxiv - Neuroscience 2019Quote: ... Mice were genotyped by PCR on tail DNA using REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the GenElute PCR Clean-up kit (Sigma Aldrich, St. Louis, MO, USA) according to instruction manual ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were purified with the GenElute PCR Clean-up kit (Sigma Aldrich, St. Louis, MO, USA) as per instruction manual and triplicates were pooled and diluted 1:5 for a second PCR with Illumina adapter sequences ...
-
bioRxiv - Physiology 2021Quote: ... DNA fragments were directly purified from the PCR mix using the GenElute PCR Clean-Up Kit (Sigma-Aldrich). Gibson assemblies were performed with the NEBuilder HiFI DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... as established with a PCR-based test (LookOut® Mycoplasma PCR Detection kit, Sigma-Aldrich, St. Louis, MO).
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the GenElute PCR Clean-up kit (Sigma Aldrich, St. Louis, MO, USA) according to instruction manual ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were cloned into pET28a (Novagen), pET28 His6 Sumo TEV LIC (1S ...
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... PCR was performed using invadolysin primers (Sigma) designed to selectively amplify the invadolysin transgene ...
-
bioRxiv - Developmental Biology 2019Quote: ... and PCR Grade Proteinase K (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... 1x PCR buffer (pH=8.7; Sigma, Germany) and 1 μl (30–50 ng ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 8.75 µl of PCR water (Sigma). Reactions were performed on an Mx3005P qPCR System (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... PCR II products were purified by Millipore MultiScreen® PCRμ96 plate according to manufacture instructions and eluted in 30 μL of nuclease-free water (DEPC) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR primers were purchased from Sigma-Aldrich. Zebrafish primer sequences have been previously published (Lim et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The KAPA Taq PCR kit (Sigma, BK1000) was used in conjunction with three primer sequences (wild type ...
-
bioRxiv - Neuroscience 2019Quote: RedTaq ReadyMix PCR Reaction Mix (Sigma Aldrich), 1 µl of cDNA (obtained as described above ...
-
bioRxiv - Physiology 2020Quote: ... The mouse RT-PCR primers (Sigma-Aldrich) used are shown in Supplementary Tab ...
-
bioRxiv - Immunology 2022Quote: ... The PCR products and pET16b vector (Novagen) were digested with NdeI and XhoI at 37°C for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and Expand high-fidelity PCR (Sigma-Aldrich) were used to synthesize and amplify the cDNAs ...
-
bioRxiv - Microbiology 2019Quote: ... PCR primers were purchased from Sigma-Aldrich and are listed in S7 Table ...
-
bioRxiv - Genomics 2021Quote: ... PCR primers were obtained from Sigma-Aldrich at 100 µM concentration in H2O ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified using SpeedBeads (Sigma) and eluted with 15 μL of nuclease-free water ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified using SpeedBeads (Sigma) and sequenced by Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... the KAPA3G Plant PCR Kit (Sigma-Aldrich) was used to amplify an 824 bp fragment spanning the gene target site using an initial touchdown for 6 cycles with annealing at 70°C decreasing by 1.6°C per cycle followed by 34 cycles annealing at 62.1°C ...
-
bioRxiv - Physiology 2023Quote: ... REDExtract-N-Amp PCR ReadyMix (R4775, Sigma) was used ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified using SpeedBeads (Sigma) and sequenced by Sanger sequencing.
-
bioRxiv - Immunology 2023Quote: ... and the following PCR primer sequences (Sigma): Gapdh (F ...
-
bioRxiv - Biochemistry 2023Quote: Mycoplasma PCR Detection Kit (LookOut, Sigma-Aldrich) Colloidal Blue Staining Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The SYBR Green quantitative PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PCR primers were purchased from Sigma, and the Biotin-TEG DNA antisense oligos were designed in Stellaris probe designer and purchased from IDT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and real-time quantitative reverse transcriptase PCR analysis (qRT-PCR) was performed using SYBR Green® reagent (Sigma Aldrich) as previously described (46) ...
-
bioRxiv - Genetics 2022Quote: ... Real-time PCRs were done in a 10 μl volume using the Absolute quantitative PCR SYBR Green mix (Sigma) in a 96-well plate ...
-
bioRxiv - Genetics 2019Quote: ... 50 uL of PCR product of each sample was purified with SpinPrep PCR Clean-Up Kit (EMD Millipore Corp) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... the tagmented DNA was amplified by PCR using the KAPA2G Robust PCR kit (Sigma-Aldrich, St. Louis, MO, USA) using the GC buffer along with 0.2 μM of each custom P5 and P7 indexing primers (File S1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Template plasmid was digested using DpnI and the PCR products were purified using a PCR purification kit (Sigma-Aldrich). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified DNA was then purified by depositing the PCR products in a 96-well MultiScreen PCR plate (Millipore). A vacuum of 15 inHg was applied to the wells containing the PCR products until all the wells were dry (12-15 minutes) ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR conditions were set up to amplify only the short 670 bp product using REDExtract-N-Amp PCR ReadyMix (Sigma). PCR conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Neuroscience 2022Quote: Genotyping for the R1.40 transgene locus was done with the recommended PCR primers using the PCR Ready Mix kit (E3004; Sigma-Aldrich). The sequences of the genotyping primers were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... amplified by PCR with Phusion U Hot Start PCR MasterMix (Thermo-Fischer Scientific) in presence of 0.5 mM betaine (Sigma-Aldrich) using universal bacterial primers (27F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT ...
-
bioRxiv - Genetics 2021Quote: ... Purification of genomic Polymerase Chain Reaction (PCR) amplified DNA was performed with the GenElute PCR Clean-Up kit (Sigma-Aldrich) or the GeneJET PCR Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Gene expression was measured by quantitative RT-PCR and normalized to β-actin8,48 The SYBR Green quantitative RT-PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Genomics 2020Quote: ... The painting probes were generated from the DOP-PCR amplified samples by a secondary DOP-PCR incorporation of biotin-dUTP and digoxigenin-dUTP (Sigma) [25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18bp of the reverse complement of the beginning of the DNA tag sequences was added to the 5’ of the reverse primer so that the CRM can be combined with the DNA tag in equal amount using overlap PCR (Xiong et al., 2006) using Expand High Fidelity PLUS PCR (Sigma). The resulting fragment was run on 2% agarose 1x TAE gel ...