Labshake search
Citations for Millipore Sigma :
3351 - 3400 of 4935 citations for SARS Coronavirus Spike Glycoprotein S1 Mosaic N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... β-hexosaminidase substrate (4-nitrophenyl N-acetyl-β-D-glucosaminide, 4 mM, Sigma) was then added to the supernatant and lysate for 1 h at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: WT and emx2el586/el586 heterozygous incrosses were incubated in 0.003% N-Phenylthiourea (Sigma). At 48 hpf ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell pellet was collected and suspended in N-Ethylmaleimide (NEM) solution (Sigma Aldrich), and the resulting cell suspension was precipitated ...
-
bioRxiv - Biochemistry 2023Quote: ... Sensitivity to NO-inducing agents S-nitroso-N-acetyl penicillamine (SNAP) (N3398, Sigma) and Z)-1-[2-(2-Aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA/NONOate ...
-
bioRxiv - Biochemistry 2024Quote: ... Fresh stocks of the monovalent reagents N-(propionyloxy)succinimide ester (PropNHS, Sigma-Aldrich), Biotin-X-NHS (Biotin-NHS ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing N-WASP were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) and further purified by size exclusion chromatography using a Superdex 200 prepgrade column (Cytiva ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received intraperitoneal injections of clozapine-N-oxide (CNO, Sigma, dissolved in saline) 10 minutes prior to the resident-intruder test.
-
bioRxiv - Biophysics 2023Quote: ... sodium chloride and trimethylamine N-oxide (TMAO) were all purchased from Sigma-Aldrich as previously reported (15,18-23) ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... culture medium consisting of advanced DMEM/F12 supplemented with N-Acetylcysteine (Sigma-Aldrich), B plus supplement (bioGenous) ...
-
bioRxiv - Physiology 2023Quote: ... DNA extraction was done using REDExtract-N-Amp Tissue PCR kit (XNAT, Sigma). For the PCR reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... Negative control samples were prepared using 10 mM N-ethymaleimide (NEM, Sigma-Aldrich) instead of mPEG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and N-acetyl-L-cysteine (NAC) (A9165) were from Sigma (Burlington, MA, USA). Rat tail collagen (354236 ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were coated in Fibronectin (40µg/ml – ref. n°F1141 Merck/Sigma-Aldrich). WM1862 ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.17mg/ml tricaine (ethyl-3-aminobenzoatemethanesulfonate, ref. n°E10521, Merck/Sigma-Aldrich). WM983B cells of different lysosome clustering status (spread ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-(N-Ethyl Carboxamide) adenosine (NECA) was purchased from Sigma-Aldrich (Cat. #119140), dissolved in DMSO to 10 mM stock ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Primary antibodies used for immunofluorescence were rabbit anti CCDC15 (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further derivatized with 10 μL tert-butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma, 394882) and incubating at 70°C for 60 minutes.
-
bioRxiv - Physiology 2023Quote: ... and plasma insulin (n=5) was analyzed by ELISA (EZRMI-13K, Sigma Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... specifically N-[2-(p-Bromocinnamylamino) ethyl]-5-isoquinolinesulfonamine dihydrochloride (H89, B1427, Sigma-Aldrich), were utilized in this study.
-
bioRxiv - Cell Biology 2024Quote: ... The N-terminal hexahistidine tag was cleaved with ∼2 units of thrombin (Sigma) per 1 mg of protein ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated with 4 mM N-Acetyl-L-Cysteine (NAC) (Sigma-Aldrich) for 72 h ...
-
bioRxiv - Neuroscience 2024Quote: ... dechorionated at 24 hpf and incubated with 0.3% N-phenylthiourea (PTU; Sigma-Aldrich) to inhibit melanogenesis ...
-
bioRxiv - Biophysics 2024Quote: ... A stock solution was made of 1M N-ethylmaleimide (NEM; Sigma-Aldrich, USA) dissolved in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Anti-CCDC66 antibody was generated by immunizing rats (Koc University ...
-
bioRxiv - Biochemistry 2024Quote: ... with an N-terminal Myc-DKK tag and pETDuet-1 (Sigma-Aldrich, 71146) were used for expression in mammalian cells and bacteria ...
-
bioRxiv - Biochemistry 2024Quote: ... and 12.5 µl of 4-methylumbelliferyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) was incubated for 15 minutes at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the lysates were supplemented with 20 mM N-ethylmaleimide (NEM; E3876, Sigma-Aldrich) and mixed with loading buffer without β-mercaptoethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotyping was conducted with RED Extract-N-Amp (Sigma-Aldrich, St. Louis, MO) using primers R1965 5′ GCT CAA GGT TGT ATG CCT TGG TGC T 3′ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Male mice (n=25) were gavaged with tideglusib or 26% peg-400 (Sigma), 15% Cremophor EL (Sigma) ...
-
bioRxiv - Synthetic Biology 2024Quote: 3-O-C6-HSL (N-(B-Ketocaproyl)-L-Homoserine Lactone from Sigma-Aldrich, cat # K3007 ...
-
bioRxiv - Immunology 2021Quote: ... coli O55:B5 that does not contain sialic acid was purchased from Sigma Aldrich (cat# L2880).(Lindberg et al ...
-
bioRxiv - Microbiology 2020Quote: ... coli DH10B pks− were seeded in a 96-well plate in LB liquid medium (Sigma-Aldrich). The optical density (OD ...
-
bioRxiv - Molecular Biology 2021Quote: Mouse placental samples: Samples were obtained using the intraperitoneal injection LPS (Escherichia coli O111:B4; Sigma) model that results in 100% preterm labor/birth [40] ...
-
bioRxiv - Molecular Biology 2021Quote: ... the expression vector was transformed into Rosetta 2 (DE3) pLysS Escherichia coli (Novagen, Madison, WI, USA). An E ...
-
bioRxiv - Immunology 2019Quote: ... mice were treated with 15 mg/kg BW LPS (Escherichia coli serotype O55:B5; Sigma-Aldrich) with or without 10 mg/kg BW M3 and were evaluated twice daily for 7 days.
-
bioRxiv - Immunology 2021Quote: ... mice received an intraperitoneal injection of either 2 mg/kg LPS (Escherichia coli 026:B6, Sigma) in PBS or PBS alone ...
-
bioRxiv - Microbiology 2022Quote: Wild type and mutant CANC proteins were expressed in Escherichia coli Rosetta (DE3) cells (Merck Millipore) as previously described (Betancor et al. ...
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 growing in LB were treated with 100 μg/ml Cephalexin (Sigma-Aldrich, Mumbai, India) for 2 hours ...
-
bioRxiv - Plant Biology 2021Quote: ... The resultant expression vector was transformed into Escherichia coli BL21 (DE3) cells (Sigma-Aldrich, MO, USA).
-
bioRxiv - Neuroscience 2020Quote: 330 µg/kg LPS (from Escherichia coli serotype 0111:B4, Sigma-Aldrich, St. Louis, MO, USA) dissolved in 0.9% sterile saline or 0.9% sterile saline control (SAL ...
-
bioRxiv - Microbiology 2020Quote: THP-1 cells were treated with 100 ng/mL LPS from Escherichia coli (Sigma-Aldrich – L6895) or media only (mock treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... the other received LPS (1μg/5μl; Escherichia coli O55:B5 Sigma-Aldrich; St. Louis, MO, USA) according to protocols previous optimized for volume (16 ...
-
bioRxiv - Genetics 2021Quote: BMDM or ESDM were primed with 1μg/mL LPS from Escherichia coli O55:B5 (Sigma, L6529) for 4 hours at 37°C and subsequently treated with 5mM adenosine triphosphate (ATP ...
-
bioRxiv - Microbiology 2020Quote: ... coli and Lactobacillus was isolated using the GeneElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich, USA) as described in the user manual ...
-
bioRxiv - Immunology 2020Quote: Lipopolysaccharide from Escherichia coli 055:B5 (purified by gel-filtration chromatography) was purchased from Sigma-Aldrich and freshly dissolved in sterile saline prior to intraperitoneal (i.p. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli were also grown in 2 mL Overnight Express Instant TB media (Sigma Aldrich, 71491-5) with added 100 μg/mL ampicillin ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli strain DH5-α was cultured shaking in Luria-Bertani broth (Lennox) (LB, Sigma-Aldrich) at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... coli BL21 (DE3) cells were transformed with split intein cMSP1D1 constructs inserted into pET28a vector (Novagen) in LB media + kanamycin ...
-
bioRxiv - Plant Biology 2023Quote: ... Individual expression constructs were subsequently transformed into Escherichia coli Rosetta™ 2 (DE3)pLysS cells (Novagen) for heterologous expression ...