Labshake search
Citations for Millipore Sigma :
3001 - 3050 of 7955 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Sanger sequencing of the PCR products was performed using commercial service (Sigma). The sequencing traces were examined and the fish carrying A to G mutation were selected ...
-
bioRxiv - Neuroscience 2021Quote: ... Overlapping PCR primers encoding the gRNA sequences were ordered from Sigma-Aldrich and Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 10 μl of RedExtract-N-ampl PCR reaction mix (Sigma-Aldrich), 0.8 μl of each primer (10 M) ...
-
bioRxiv - Cell Biology 2022Quote: ... All oligonucleotides used in PCR and cloning were procured from Sigma-Aldrich. Phusion® polymerase ...
-
bioRxiv - Microbiology 2019Quote: ... gel-purified PCR products were ligated into the pET15b expression vector (Novagen). Expression in E ...
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... and inserting the H6-SpeI-mScarlet PCR product into pET28a (Novagen #69864) using NcoI and BamHI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was carried out using SYBR Green JumpStart Taq ReadyMix (Sigma) using the appropriate primers (Figure 2-source data 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed with the KOD Hot-start 2× master mix (Novagen), and cloning was performed using Gibson Assembly 2× Master Mix (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the region encoding GFP1–10 was PCR amplified (KOD polymerase, EMD Millipore) from pSJ1256 using primers containing the PacI and AscI (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were inserted into p3×FLAG-CMV-10 vector (Sigma-Aldrich) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Millipore 71842-3) using primers KL207/KL200 for the sfgfp gene and primers BAC338F/BAC805R for the 16S rRNA gene48.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were analysed by electrophoresis on 1% agarose gel (Sigma-Aldrich), containing SafeView (ABM) ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was verified by PCR (REDTaq® ReadyMix™ # R4775, Sigma Aldrich). The primers ...
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen®), following standard protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Samples for qPCR and qRT-PCR were homogenized in TRiZOL (Sigma Aldrich) reagent and further processed for nucleic acid extractions using manufacturer’s protocols.
-
bioRxiv - Molecular Biology 2022Quote: ... k-mer sequences were assembled using PCR from oligos purchased from Sigma.
-
bioRxiv - Biophysics 2019Quote: ... coli MG1655 genome by PCR into pET15b (Merck Millipore, Billerica, MA, USA) by Gibson assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... All oligonucleotides used in PCR and cloning were procured from Sigma-Aldrich. XT-20 high fidelity polymerase was used in all cloning protocols and purchased from GeNei Pvt ...
-
bioRxiv - Developmental Biology 2020Quote: ... we prepared this mixture for PCR: 10µL of Taq polymerase (Sigma P0982), 1µL of the premade sex primer stock ...
-
bioRxiv - Microbiology 2020Quote: ... Vectors were generated by inverse PCR using KOD Hot-start polymerase (Novagen) or by Gibson assembly in a homemade reaction master mix (100 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A PCR with REDTaq® DNA polymerase (Sigma-Aldrich, Saint Louis, Missouri) was performed and the length of the amplified products was checked by 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:10 mixed with 1x PCR buffer (Sigma Aldrich), 1.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digested PCR product was cloned into a pET-52b(+) plasmid (Novagen) in frame with an N-terminal Strep-tag II obtaining the B35SSB expression vector pET52b::B35SSB ...
-
bioRxiv - Genomics 2019Quote: ... with the SYBR Green JumpStart Taq ReadyMix for Quantitative PCR (Sigma Aldrich). Using the Primer3 software70 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using KOD Xtreme™ Hot Start DNA Polymerase (Millipore, 71975) and the primers TCGATGCTCTGTTTCGAATG and CTTCTTCCCCCTTGCCTTAC flanking the targeted deletion site ...
-
bioRxiv - Genetics 2021Quote: ... The PCR master-mix used was: Taq polymerase (Novagen NovaTaq 0.04U/μL), primers (0.5 μM each) ...
-
bioRxiv - Immunology 2020Quote: ... Amplified S-gene and polymerase chain reaction (PCR) engineered pET31b(+) (Novagen, Germany) bacterial expression vector were amplified using 0570F and 0571R primers ...
-
bioRxiv - Biochemistry 2022Quote: ... brucei genomic DNA using PCR and ligated into the pET15b vector (Novagen), which provides an N-terminal His6 tag followed by a thrombin cleavage site prior to the target protein ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was performed using KOD Hot start DNA polymerase (Millipore Sigma) since it has a low error rate unlike Taq polymerase (Engler and Marillonnet 2013) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed using JumpStart REDTaq Ready Mix (Sigma, Cat#P0982-800RXN) and the primers listed below ...
-
bioRxiv - Molecular Biology 2022Quote: ... and splice isoform specific PCRs were performed (Sigma Aldrich High fidelity Taq) using appropriate primers (Supplemental table 8 ...
-
bioRxiv - Systems Biology 2022Quote: ... PCR was performed with a proof-reading KOD polymerase (Sigma-Aldrich, 71086) using vector-specific primers.
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was performed using KOD Hot Start Master Mix (Millipore Sigma) with primers listed in Supplementary Table 6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Following the RED Extract-N-Amp Tissue PCR XNAT manufacturer’s protocol (Sigma), 2-3mm of each mouse’s tail was removed and DNA was extracted ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using the KOD Hotstart DNA polymerase (Merck Millipore). Plasmid isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (EMD Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The PCR mixture consisted of MTP Taq DNA Polymerase (Sigma-Aldrich, Germany) (0.05 u/μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sanger sequencing of the PCR products was performed using commercial service (Sigma). The sequencing traces were examined and the fish carrying A to G mutation were selected ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA Polymerase (EMD Millipore). In the via-1 strain ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction contained 1.25 U JumpStartTM Taq DNA Polymerase (Sigma-Aldrich), 1× PCR Buffer (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was subjected to agarose (Sigma–Aldrich, Cat No. A9539) gel electrophoresis using 1X tris–borate–EDTA buffer alongside a 100 base pair ladder using SafeView™ Classic (Applied Biological Materials ...
-
bioRxiv - Microbiology 2023Quote: ... at a 1:1,000 dilution. For detection the LumiGlo reagent (CST cat. no. 7003S) and a chemiluminescence film (Sigma-Aldrich cat. no. GE28-9068-36) were used.
-
bioRxiv - Plant Biology 2020Quote: ... the epidermal strip was washed three times with Milli-Q water and stained with 50 μM H2DCFDA (Sigma-Aldrich) (10 mM stock in DMSO ...
-
bioRxiv - Biophysics 2021Quote: ... cells were rinsed three times with PBS containing 0.1 g L−1 Mg2+ and 0.133 g L−1 Ca2+ (PBS++; Sigma-Aldrich) and incubated with glutaraldehyde solution (2.5% (v/v ...
-
bioRxiv - Biophysics 2020Quote: ... The cells were washed three times with PBS again and incubated with Hoechst 33342 (Sigma, 14533, 10 μg/ml) for 20 min in 37 C and washed twice with PBS before acquiring the images.
-
bioRxiv - Microbiology 2021Quote: ... Cells were pelleted a second time and resuspended in PBS supplemented with 2% heat-inactivated fetal bovine serum (Sigma). Numeration and viability were determined using Propidium Iodide marker exclusion and MACSQUANT Flow cytometer (Miltenyi) ...
-
bioRxiv - Cell Biology 2020Quote: ... Retinal organoids (n=3-4) for each time point were homogenized using a Dounce Tissue Grinder (Sigma-Aldrich, UK) and processed using SYBR™ Green Fast Advanced Cells-to-CT ™ Kit (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Membranes were washed three times for 5 min in PBST before being incubated with DAPI (50 nM; Sigma-Aldrich) as a nuclear counterstain ...
-
bioRxiv - Microbiology 2020Quote: Time-lapse imaging was performed on 1.5% agarose pads embedded with 7H9 OADC medium containing ATc (Sigma, 100ng/ml) and kanamycin (Roche ...