Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 2317 citations for 8 Fluoranthenemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 150 μL cell suspension was mixed with 150 μL DB+ containing 8 mM caffeine (Wako) and 20 μM latrunculin A (Sigma-Aldrich) and placed on a 35-mm glass bottom dish (12-mm glass in diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF10A cells were infected for 24 h using filtered viral supernatant diluted with culture medium and supplemented with 8 µg/µl protamine sulphate (Sigma-Aldrich). Selection of infected cells with antibiotics was performed 48 h after the infection.
-
bioRxiv - Microbiology 2023Quote: NIH3T3 and BMDC cells were infected with MLV (genome equivalent of a multiplicity of infection [MOI] of 1) in the presence of 8 mg/ml Polybrene (Sigma-Aldrich), and cells were incubated on ice for 1 h to allow virus binding ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transduced with HIV-TOP opt mChΔW lentivirus containing the PIKA library by spinoculation in the presence of 8 µg/mL protamine sulfate (Millipore Sigma #P3369). Two days later (Experiment Day 4) ...
-
bioRxiv - Pathology 2023Quote: ... The cells were infected with lentiviruses carrying the plasmid (MOI = 6) in the presence of Hexamethidine Bromide (8 µg/mL; Sigma-H9268) for 24 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... osm-9 gDNA was amplified with the primers KLB289 (GTTGTTTACCTTTTATGTTCATCCG) and KLB290 (AAATTTTCTACTGCCTGGTATCAAA) off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich). The osm-9 gDNA fragment plus extra upstream and downstream homologous sequence was amplified off of the gDNA amplified with KLB289 and KLB290 ...
-
bioRxiv - Cell Biology 2023Quote: ... Genetical labelling was induced in epidermis of 6-8 weeks old mice with a single topical administration of 75 μg of (Z)-4-Hydroxytamoxifen (Sigma-Aldrich) (15 mg/mL diluted in acetone).
-
bioRxiv - Bioengineering 2023Quote: ... K562 or Jurkat T cells were seeded into a 24-well plate at 2.5 × 105 cells/well in 1 ml cRPMI and transduced in the presence of protamine sulfate (8 μg/ml, Sigma-Aldrich). Transgene expression was assessed 72 hours post-transduction by flow cytometry ...
-
bioRxiv - Cell Biology 2022Quote: ... the dissociated cells were resuspended in the transduction medium (1 uL to 5 uL of lentivirus, 4 to 8 ug/ml Polybrane[STR-1003-G, Sigma Aldrich] ...
-
bioRxiv - Cell Biology 2023Quote: S2naive and S2Xpress cells were seeded in an 8-chamber Nunc LabTek II that had previously been coated with Poly-L-Lysine (P4832, Sigma-Aldrich). Cells were then incubated for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mL of S2 cell pellets were lysed with 400 μL lysis buffer containing non-ionic detergent (50 mM Tris buffer, pH 8, 150 mM NaCl, 1% IGEPAL CA- 630 (Cat# I8896, Sigma Aldrich), 10% glycerol and 1x protease inhibitor (Cat# A32965 ...
-
bioRxiv - Bioengineering 2023Quote: ... Droplets of the polymer solution were placed between activated dishes and a Sigmacote®-treated 8 mm coverslip (Sigma-Aldrich, US), and allowed to polymerize ...
-
DeCOIL: Optimization of Degenerate Codon Libraries for Machine Learning-Assisted Protein EngineeringbioRxiv - Bioengineering 2023Quote: ... They are next lysed in 300 μL lysis buffer (50 mM potassium phosphate at pH 8, 0).1 mM pyridoxal phosphate (Sigma P9255), 0.1x BugBuster (EMD Millipore Corp ...
-
bioRxiv - Cell Biology 2023Quote: ... either fresh or thawed DCs (differentiation day 8) were stimulated for 24 h with 200 ng/ml lipopolysaccharide (LPS; E. coli O26:B6, Sigma-Aldrich) and used for experiments on day 9 ...
-
bioRxiv - Genetics 2023Quote: ... RBC lysis buffer (8% Ammonium chloride [NH4Cl], 0.8% Sodium bicarbonate [NaHCO3, Sigma-Aldrich, USA] and 0.4% Ethylenediaminetetraacetic acid [EDTA, Sigma-Aldrich, USA]).
-
bioRxiv - Cell Biology 2023Quote: ... MPP4 (7 x 104 cells per well) were sorted directly into 8-well plates pre-coated with poly-lysine (Sigma-Aldrich) and containing XF DMEM medium ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Both the urate oxidation to HIU and the reverse reaction were assayed in the presence of the urate oxidase inhibitor 8-azaxanthine (AZA; 11460, Sigma-Aldrich), which was added to the reaction mixture at a final concentration of 50 μM.
-
bioRxiv - Microbiology 2023Quote: ... The normal group was intraperitoneally administered a dose of 8 mL/kg of 0.5% carboxy methyl cellulose (Sigma-Aldrich, MO, USA) as an excipient ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mg of hymenophore tissue from each specimen was homogenized in 2.0 ml screw-cap tubes containing a single 3.0 mm and 8 x 1.5 mm stainless steel beads using a BeadBug™ microtube homogenizer (Sigma-Aldrich, #Z763713) for 120 seconds at a speed setting of 3500 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... Infection of PC3-AR-DTX3LKO cells were carried out in the growth medium (RPMI 1640 + 5% FBS + 1% Penicillin-Streptomycin solution) in the presence of 8 µg/ml of hexadimethrine bromide (Sigma H9268). After 2-3 cell doublings ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both HCC1954WT and HCC1954KO cells were transduced with the pLenti CMV Puro LUC reporter vector at MOI = 5 in the presence of 8 μg/mL of Polybrene (Sigma-Aldrich). Infected cells were selected by puromycin (2.5 μg/mL for 72h ...
-
bioRxiv - Molecular Biology 2023Quote: ... HelaS3 cells were transduced for 48 h in 6 well plate in 1 ml of medium containing 8 µg/mL of polybrene (Sigma-Aldrich). VHL-NbGFP4-FLAG HelaS3 cell line was obtained after selection with 1 µg/mL of puromycin (Invivogen).
-
bioRxiv - Genetics 2023Quote: ... Experimental Villin-CreERT2 Hnf4 mutant mice (8–12 weeks old) were intraperitoneally administered tamoxifen at 50 mg/kg/day (Sigma, T5648). Wild-type ...
-
bioRxiv - Genomics 2023Quote: ... Samples were separated on SDS-PAGE (stacking 4% and resolving (8% top and 15% bottom)) and the protein-resolved gel was transferred onto a PVDF membrane (Millipore, #IPVH00010) in a 1X transfer buffer (25 mM Tris ...
-
bioRxiv - Immunology 2023Quote: ... virus supernatant was aspirated and preactivated PBMCs (0.5-0.8 x 106/well) in TexMACS medium supplemented with 100 IU/ml IL-2 and 6 ng/ml polybrene (Sigma-Aldrich) were added to each well ...
-
bioRxiv - Immunology 2023Quote: ... MRC-5/hTERT cells were subsequently transduced with the lentivirus-containing supernatants in the presence of polybrene (8 μg/mL, Sigma-Aldrich) and were selected with puromycin (2 μg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: Dissected tumors were washed in PBS and homogenized at room temperature in urea lysis buffer (8 M urea, 40 mM Tris pH 7.6, 5% SDS supplemented with phosphatase inhibitor cocktails 2, 3 (Sigma P5726, P0044)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% TritonX100 in 2 × SSC), anti-bleaching buffer (50 mM Tris-HCl pH 8, 300 mM NaCl, 3 mM Trolox (Sigma 238813), 0.8% D-glucose (Nacalai Tesque 168060-25) ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans genomic DNA extracted from 8-10 adult worms using the Extract-N-Amp™ Tissue PCR Kit (Millipore Sigma, MA) as previously described38 then sequenced ...
-
bioRxiv - Biochemistry 2023Quote: Clicked and dissolved protein samples were diluted to 4 M urea with 50 mM ammonium bicarbonate (pH 8, AmBic, Sigma-Aldrich). The proteins were reduced with 4 mM DTT (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... for 1 h on ice in culture medium in the presence of 100 µg ml-1 cycloheximide and 8 µg ml-1 polybrene infection reagent (#TR-1003-G, Sigma- Aldrich) and then placed at at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 3.5 x 107 K562 cells expressing Cas9-BFP were resuspended into 60 ml of viral media with 8 μg/ml polybrene (hexadimethrine bromide, Sigma-Aldrich) in 6-well plates ...
-
bioRxiv - Biochemistry 2024Quote: ... Adherent Expi293 cells were infected with concentrated lentiviral particles at 75% confluency in adherent culture media supplemented with 8 μg/mL polybrene (Sigma-Aldrich), then incubated for 48 h at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: Whole gastrocnemius skeletal muscle samples were obtained from the limb contralateral to the tumor-implanted flank and cryo-embedded in transverse myofiber orientation protruding from a 1:8 volume mixture of Gum Tragacanth powder (Sigma-Aldrich) to Tissue Freezing Medium (TFM ...
-
bioRxiv - Biophysics 2024Quote: ... Wild-type 3T3 cells at 60-80% confluency were incubated for 24 h with 100X virus suspension and 8 µg/ml of Polybrene Transfection Reagent (Millipore Sigma). To maintain stable knockdown ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus-containing media was harvested at 72-hour post-transfection and used to infect the H82 cells with 8 µg/mL Polybrene (Sigma #TR1003G). GFP+ cells were selected by fluorescence-activated cell sorting after 72-96 hours on a BD FACSAria II using FACSDiva software.
-
bioRxiv - Cancer Biology 2024Quote: ... were washed two times with PBS and lysed by scraping into 500 μl per plate of lysis buffer (40 mM Tris/HCl pH 7.6, 8 M urea, EDTA-free protease inhibitor complete mini [Roche], and phosphatase inhibitor cocktails 1, 2, and 3 [Sigma-Aldrich] at 1× final concentration according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... the afferent and efferent vessels of the sCLNs and the dCLNs were securely ligated employing a nylon suture (8–0 Nylon non-absorbable monofilament suture; Sigma Aldrich). The incision area was then sutured ...
-
bioRxiv - Neuroscience 2024Quote: The electrolyte bath was comprised of an aqueous solution containing 2.5 mmol chloroplatinic acid (H2PtCl6, 8 wt% H2O, Sigma-Aldrich, 262587). The wafers were partially submerged in this solution using a custom-built wafer holder ...
-
bioRxiv - Bioengineering 2024Quote: ... devices were plasma treated again for two and a half minutes and 10 µL of 8% Pluronic F68 (P1300, Sigma-Aldrich) was added to the device to prevent cell sticking ...
-
bioRxiv - Genomics 2024Quote: ... Jurkat cells expressing Zim3-dCas9-P2A-mCherry were transduced with dJR092 library lentivirus by spinfection (1000g) with polybrene (8 µg/mL, Sigma-Alrich) with a targeted low infection rate of ∼10% ...
-
bioRxiv - Cell Biology 2024Quote: Cell differentiation was conducted using previously described protocol 32 with slight modifications by using sequential inhibition of GSK-3 by CHIR99021 (8 µM, Sigma-Aldrich) and WNT by IWP-2 (5 µM ...
-
A conserved germline-specific Dsn1 alternative splice isoform supports oocyte and embryo developmentbioRxiv - Cell Biology 2024Quote: ... 6–8-week old B6D2F1 females were hormone primed by an intraperitoneal injection of pregnant mare serum gonadotropin (PMS, EMD Millipore) followed 46 hours later by an injection of human chorionic gonadotropin (hCG ...
-
bioRxiv - Microbiology 2024Quote: ... media was removed from the cells and replaced with 1 ml of mCherry lentivirus supernatant mixed with 8 ug Polybrene Infection / Transfection Reagent (Sigma-Aldrich). 24 hours after lentivirus addition ...
-
bioRxiv - Molecular Biology 2024Quote: ... the medium was replaced with medium containing 2X concentrated virus medium and 8 μg/ml polybrene (Millipore Sigma, TR-1003-G). The virus-containing medium was replaced with fresh medium 24 h post transduction.
-
bioRxiv - Bioengineering 2024Quote: ... in SM buffer (50 mM Tris-HCl, 100 mM NaCl, 8 mM MgSO4, 0.01% gelatin (Sigma-Aldrich, USA, Cat. No. G7041), pH = 7.50) ...
-
bioRxiv - Physiology 2024Quote: ... cells were not serum-deprived and incubated 24h after seeding with no secretagogue (Basal) or with 10-8 M AngII (Sigma-Aldrich), 12 mM K+ (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti- cytokeratin 8 (TROMA-I; Developmental Studies Hybridoma Bank; 1:500) and rabbit anti- Sox9 (Millipore, Burlington, MA; 1:750). Detection of antibody binding was with the appropriate species-specific Biotin-SP-conjugated goat anti-antibodies (1:400 ...
-
bioRxiv - Immunology 2024Quote: ... and for reconstitution experiments were transduced for 48 h with the respective lentiviral particles (see below) in the presence of polybrene (8 μg/ml, Sigma-Aldrich) prior to selection with puromycin (1 μg/ml ...
-
bioRxiv - Systems Biology 2024Quote: Protein solutions (supernatant from homogenized tissues and cells) were dissolved in 100 mmol/L ABC with 8 mol/L urea (Sigma-Aldrich). The proteins were reduced with TCEP (Sigma-Aldrich) ...