Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 7955 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... they were washed 3 times in PBS and mounted in Mowiol (Sigma-Aldrich). Images were collected using a confocal microscope (Olympus FV1200 ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were washed three times with PBS containing 0.05% Tween 20 (Sigma) before incubations with 20 μg/mL propidium iodide (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 times by centrifugal filtration (3K Amicon Ultra, Merck Millipore, 14’000g, 4°C) and buffer was exchanged to 4M Guanidine hydrochloride in 50mM HEPES (pH 7.8) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells were washed 3 times and maintained in XF-DMEM (Sigma-Aldrich) supplemented with 1 mM sodium pyruvate and 17.5 mM glucose ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were rinsed several times in 1x PBS/0.1% Tween-20 (Sigma Aldrich) (PBS-T) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were rinsed 5 times with PBST (0.1% Tween 20 in PBS, Sigma), and incubated with Alexa fluorophore secondary antibodies (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The grids were washed 3 times with 1% bovine serum albumin (BSA; Sigma) in DPBS and blocked in 0.1% gelatin (Aurion ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were washed three times and blocked with 2% BSA (Sigma-Aldrich, #A8022) in PBST for 1 h at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were synchronised with a 6h time window by 5% sorbitol lysis (Sigma) during ring stage ...
-
bioRxiv - Biochemistry 2020Quote: ... the liposomes were washed 8 times with a 100 KD ultrafiltration tube (Millipore) by centrifuging them with buffer L for 20 min at 4°C at a rate of 4,000 × g to remove any external Tb3+ ...
-
bioRxiv - Developmental Biology 2021Quote: ... The epididymal tissue was incised multiple times and incubated in M2 medium (Sigma) or PBS at 37°C for 15-30 min.
-
bioRxiv - Cell Biology 2020Quote: ... rinsed three times with DPBS and then permeabilized with 100% methanol (Sigma-Aldrich) for 3 min ...
-
bioRxiv - Genomics 2020Quote: ... Samples were washed with TLE 3 times in 30KDa amicon columns (MilliPore # UFC5030BK). Both SisterC and Hi-C libraries were then enriched for biotin-containing fragments by pull down with MyOne Streptavidin C1 beads (Life Tech #65-001) ...
-
bioRxiv - Immunology 2020Quote: ... Third-stage larvae (L3) were washed ten times with PBS (Dulbecco’s PBS, Sigma) before infection ...
-
bioRxiv - Immunology 2021Quote: ... The plates were washed (5 times with PBS-T) and AP substrate (Sigma) was added ...
-
bioRxiv - Neuroscience 2020Quote: ... washed 3 times in 0.3% PBST (0.3% Triton-X100 in PBS, Sigma-Aldrich), blocked in 5% goat serum (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed 3 times in M9 and frozen at −80°C in Trizol (Sigma) before RNA preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed 3 times with 1X PBS and mounted with Fluoroshield with DAPI (Sigma). Images were acquired with a Nikon Perfect Focus Eclipse Ti live-cell fluorescence microscope ...
-
bioRxiv - Biophysics 2020Quote: ... for 10 min and washed three times in PBS (Sigma-Aldrich, D8537-500ML) prior to imaging.
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed three times with PBS and fixed in 4% paraformaldehyde (Sigma), followed by blocking in 5% BSA with 0.2% Triton X-100 for 30min and incubation with primary antibody Axin1 (#2087 ...
-
bioRxiv - Immunology 2022Quote: ... Third-stage larvae (L3) were washed ten times with PBS (Dulbecco’s PBS, Sigma) before infection ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were washed 5 times in TBS + 0.1% Tween 20 (Sigma Aldrich, P1379) before being incubated for 1 h at room temperature with secondary antibodies HRP conjugated (Bethyl ...
-
bioRxiv - Bioengineering 2024Quote: ... and the cells were washed three times with PBS (Sigma-Aldrich, Darmstadt, Germany). Then ...
-
bioRxiv - Immunology 2024Quote: ... Slides were then washed three times and incubated with streptavidin-HRP (Sigma, UK) at room temperature for 30 minutes before washing a further three times in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... washed in PBS three times and developed with 0.5% of 3,3’-diaminobenzidine (SIGMA) and 0.01% H2O2 in PB for about 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were washed three times with PBS and incubated with Hoechst (Sigma–Aldrich) and secondary goat anti-rabbit or anti-mouse antibodies by 1h in the dark at room temperature ...
-
Red Algae-Derived Mineral Intervention to Counter Pro-inflammatory Activity in Human Colon OrganoidsbioRxiv - Molecular Biology 2022Quote: ... membranes were washed three times in PBS before blocking in 3% BSA (Sigma) in PBS for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... then washed for 5 times with an Amicon Ultra filter (Millipore Sigma, UFC505096). Resulting conjugated antibodies were then buffered with at least 30% v/v Candor Antibody Stabilizer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and washed three additional times in 1X DPBS containing 0.04% BSA (Sigma Aldrich). Single-cell suspensions were counted using an automated cell counter (TC20 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were washed 2 times and permeabilized in binding buffer (0.1% saponin (Sigma) and 0.2% BSA (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... then washed three times in DPBS containing 1% bovine serum albumin (BSA; Sigma). Bleached oocysts were stored for up to 1 week in DPBS plus 1% BSA at 4 °C before infection ...
-
bioRxiv - Genetics 2023Quote: ... incubated four times in 30 mL of PBS 3 mM EDTA (Sigma-Aldrich), and digested in 20 mL of DMEM added with 20% FCS and 100 U/ml of collagenase (Sigma-Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... Beads were prepared by washing 3 times with 1x wash buffer (Sigma-Aldrich, W0390 ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were washed three times with PBS containing 0.1% Tween-20 (Sigma-Aldrich). Secondary-antibody incubations were performed at room temperature for 45 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... The samples were then washed 3 times with PBS-Tween 20 (1379, Sigma) 0.1% and incubated in a blocking solution (PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... were then washed three times in PBS-/- + 0.1% Triton X-100 (PBX; Sigma), and permeabilized in PBS-/- + 0.5% TritonX-100 for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... cells were washed three more times with PBS (Sigma-Aldrich, D8537-500 ML) and stored at 4 °C until imaging.
-
bioRxiv - Bioengineering 2024Quote: ... washed three times and incubated for 1 hr with secondary antibodies (Millipore Sigma, cat ...
-
bioRxiv - Immunology 2023Quote: ... blood was diluted two times on phosphate-buffered saline (PBS, Sigma Aldrich, USA) and centrifuged at 600 g ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed 3 times in PBS and mounted with Mowiol (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2024Quote: ... and incubated over different time points before MesNa (Sodium 2-mercaptoethanesulfonate, Sigma# M1511) reduction ...
-
bioRxiv - Cell Biology 2024Quote: ... NBD fluorescence was monitored over time after the addition of dithionite (Sigma, 71699) to a final concentration of 10 mM ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... we injected 4-Hydroxytamoxifen (H6278, Sigma-Aldrich, 1 mg/kg i.p., 3 times) into pups at P7 to P9 ...
-
bioRxiv - Microbiology 2024Quote: ... yeast cells were pelleted and washed three times in cold PBS (Sigma-Aldrich). Protein was extracted and digested before subjecting to LC/MS-MS analysis following the workflow presented in Supplementary Information 1 (SI1) ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR conditions were set up to amplify only the short 670 bp product using REDExtract-N-Amp PCR ReadyMix (Sigma). PCR conditions ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... amplified by PCR with Phusion U Hot Start PCR MasterMix (Thermo-Fischer Scientific) in presence of 0.5 mM betaine (Sigma-Aldrich) using universal bacterial primers (27F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT ...
-
bioRxiv - Genomics 2020Quote: ... The painting probes were generated from the DOP-PCR amplified samples by a secondary DOP-PCR incorporation of biotin-dUTP and digoxigenin-dUTP (Sigma) [25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...