Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 10000+ citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Predesigned MISSION siRNA’s targeting individual genes were ordered from Sigma-Aldrich; the top 3 rated siRNA’s based on expected efficacy for each gene target were pooled together and transfected concurrently ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene deletion was achieved by intraperitoneally (i.p.) administration of tamoxifen (Sigma; 10 mg/kg ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs targeting the genes of interest were purchased from Sigma-Aldrich, including shRNAs targeting S100A11 (TRCN0000289926) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1clones and esiRNA for respective genes were purchased (Sigma-Aldrich). Specific pLKO.1 clones for each gene were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... TLK2 genes could be knocked out ubiquitously by tamoxifen (Sigma #T5648) via intraperitoneal injection in 75 mg/kg body weight once every 24 hours for a total of 5 consecutive days ...
-
bioRxiv - Molecular Biology 2023Quote: ... gene expression was induced by addition of Doxycycline (Sigma, D9891-10G) to a final concentration of 100 ng/ml for 24 h ...
-
bioRxiv - Biochemistry 2023Quote: Lysozyme gene was amplified from the pLysS plasmid (Millipore Sigma-Novagen) with the oligonucleotide primers Fw-lys-NdeI (CCCATATGGCTCGTGTACAGTTTAAACAACGTG ...
-
bioRxiv - Biochemistry 2023Quote: Lysozyme gene was amplified from the pLysS plasmid (Millipore Sigma-Novagen) with the oligonucleotide primers Fw-lys-NdeI (CCCATATGGCTCGTGTACAGTTTAAACAACGTG ...
-
bioRxiv - Genomics 2022Quote: ... Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID: TRCN0000255746) and cloned into the pLKO.5-puro lentiviral construct (Sigma SHC201) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primer sequences used to amplify genes were purchased from Sigma-Aldrich and are listed in Supplementary Table S3.
-
bioRxiv - Cancer Biology 2021Quote: ... CLK2 (1:1000, sigma, HPA055366-100UL), phosphorylated SR proteins (clone 1H4, 1:500, Millipore, #MABE50. Beta-Tubulin (1:5000, Sigma Aldrich, #T7816) and Beta-Actin (1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were used to detect the following proteins: GFP (1:200, CST, cat. # 2956,), peripherin (1:1000; Novus, cat. # NBP1-05423, NF200 (1:500, Millipore, cat # MAB5266). Primary antibodies were applied and incubated at 4 °C overnight ...
-
bioRxiv - Biophysics 2020Quote: mamM CTD gene from Magnetospirillum gryphiswaldense MSR-1 (UniProt Q6NE57 residues 215-318) was previously cloned into pET28a(+) vector (Novagen, Merck Biosciences, Germany)22 ...
-
HIV-1 Nef interacts with LMP7 to attenuate immunoproteasome formation and MHC-I antigen presentationbioRxiv - Microbiology 2019Quote: Nef and LMP7 genes were cloned into pGEX-6P-1 (GE, Boston, MA, USA) and pET-28a plasmids respectively (Novagen, Madison, WI, USA). pGEX-6P-1 empty plasmid and pEGX-6P-1-Nef plasmid were respectively transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2023Quote: ... Reversal of latent HIV-1 gene expression in J-Lat 10.6 cells was performed by treatment with prostratin (Sigma, St. Louis, MO, USA) or TNFα (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... Synaptic puncta were identified by the co-localization of pre-synaptic Vesicular Acetylcholine Transporter (VAChT) protein and the post-synaptic Shank protein in MAP2 stained neurons using rb anti-VAChT (Sigma Aldrich; 1:1000), ms anti-shank (Neuromab ...
-
bioRxiv - Microbiology 2020Quote: ... release was used as a measure of necroptosis in bone marrow derived macrophages (BMDM) from 2 independent experiments according to the manufacturer’s instructions (Sigma-Aldrich, MAK066-1KT). Bone marrow derived macrophages were harvested from 8 – 10-week-old mice and grown in 20% L929 conditioned RPMI medium as described (31) ...
-
bioRxiv - Systems Biology 2020Quote: ... For macrophage differentiation U937 cells were suspended in medium with 20 ng/mL phorbol 12-myristate 13-acetate (PMA, Sigma Aldrich, #P1585) and plated in 96-well microplates with µClear®flat bottom (Greiner ...
-
bioRxiv - Immunology 2020Quote: Murine Hoxb8 is a myeloid progenitor cell line that can be differentiated to monocytes or macrophages upon removal of β-estradiol (Sigma-Aldrich) (Wang et al. ...
-
bioRxiv - Microbiology 2024Quote: ... cell differentiation into macrophages was induced by adding 50 nM phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, St. Louis, MO, USA) to the medium for 72 hours.
-
bioRxiv - Immunology 2024Quote: ... cell lysates of macrophages were removed and the infected Vero cells were overlaid with the Vero culture medium containing 0.5% methylcellulose (Sigma-Aldrich; Merck KGaA) for 4 days ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... GLP-1 and GIP-1 EIA kit was purchased from Sigma-Aldrich. Nitroblue tetrazolium chloride ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Change in fluorescence from baseline to maximum response at a given agonist concentration (delta) were expressed as a percentage of maximum cellular response elicited by calcium ionophore (A23187, Sigma-Aldrich). Calcium Signalling Assay with PAR4 orthosteric site-directed mutants ...
-
bioRxiv - Biophysics 2019Quote: Human Gai1 subunit with an amino-terminal 8x histidine tag followed by a rhinovirus 3C protease side were expressed in Rosetta 2 (DE3) cells (EMD Millipore) using pET21a ...
-
bioRxiv - Cell Biology 2019Quote: ... fragments of NUP153 (AAS 228-611) were fused C-terminally to GST in pGEX4T-3 and expressed in BL21 DE3 cells (Sigma CMC0014). Cell pellets were lysed (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Plant Biology 2020Quote: ... The absorbance of the reaction mixture was measured at 415 nm and the flavonoid content was expressed as milligrams per gram of dried extract based on a calibration curve prepared for quercetin (Sigma-Aldrich). The results are given as means ± SD (n = 3).
-
bioRxiv - Plant Biology 2020Quote: ... The absorbance of the reaction product was measured at 725 nm and the phenolic content was expressed as milligrams per gram of dried extract based on the calibration curve prepared for chlorogenic acid (Sigma-Aldrich). The results are given as means ± SD (n = 3).
-
bioRxiv - Microbiology 2019Quote: ... we performed growth curves in YPD liquid medium containing different concentrations of Gal-3 (Gal-3 human recombinant, expressed in E. coli, Sigma-Aldrich) in a 96-well plate (Costar ...
-
bioRxiv - Neuroscience 2022Quote: FLAG-APP770 was expressed in BMECs using an adenoviral system and purified from cell lysates with anti-FLAG M2-agarose (Sigma-Aldrich). The lyophilized sample (30 μg of protein ...
-
bioRxiv - Plant Biology 2022Quote: ... Arabidopsis NR2 (NIA2, At1g37130, ≥ 0.5 units of NR per vial) expressed and purified from Pichia pastoris was purchased from Sigma-Aldrich (N0163). The lyophilized protein was resuspended in 50 μl of 57 mM potassium phosphate at pH 7.5 and was used directly or stored at -80°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression vectors from previous studies were used to label EGFR at the C-terminus with EGFP and mCherry.(47) These vectors were expressed in COS7 cells purchased from Sigma Aldrich. COS7 cells were cultured in DMEM (Calsson Lab ...
-
bioRxiv - Microbiology 2023Quote: ISG20 was expressed in E.coli BL21(DE3) Rosetta/pLysS strain (Thermo Fisher Scientific, cat. EC0114 and Sigma Aldrich, cat. 71403, respectively). Bacterial cells were grown in an LB medium for 16 hours at 25°C ...
-
bioRxiv - Biochemistry 2023Quote: Hexahistidine tagged hMDC1 BRCT (residues: 1891 – 2089) was cloned into pET47b vector and expressed in Rosetta™ 2(DE3) cell lines (Novagen). Cells in 1L Luria Broth (LB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells and expressed in liter amounts in 2xYT media (FORMEDIUM, UK) in the presence of 100 μg/mL of ampicillin (SIGMA Co). Cells were grown at 37°C to an OD600 of 0.6 ...
-
bioRxiv - Biochemistry 2023Quote: ... and RAD51 L180E were co-expressed with an MBP-fusion of BRCA2 BRC4 (amino acids 1519-1551) in BL21 (DE3) cells (Novagen®) in 2xYT media ...
-
bioRxiv - Immunology 2022Quote: A 96 well ELISA plate was coated with bovine fetuin (5 μg/mL; Sigma) in carbonate buffer overnight ...
-
bioRxiv - Immunology 2020Quote: ... followed by the addition of the TMB/E ELISA substrate (Merck Millipore, Billerica, MA). Absorbance was measured as described.
-
bioRxiv - Neuroscience 2023Quote: ... IAPP was measured by an enzyme-linked immunosorbent assay (ELISA; Merck Millipore, EZHA-52K).
-
bioRxiv - Neuroscience 2019Quote: ... Subsequent labeling of oxidative protein carbonyls was performed using an OxyIHC kit (EMD-Millipore, Cat#: S7450). Derivatization of protein carbonyl groups and all subsequent steps were performed in accordance with the manufacturers instructions ...
-
bioRxiv - Neuroscience 2022Quote: RNA immunoprecipitation was performed using the Magna RIP® RNA-Binding Protein Immunoprecipitation Kit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell lysis and membrane protein extraction was performed using the ProteoExtract Native Membrane kit (Merck Millipore) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were harvested from the cells by subcellular fractionation using ProteoExtract subcellular fractionation kit (Millipore Sigma). Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... Following the estimation of protein concentration using the Quantipro BCA assay kit (Sigma-Alrich, United States), equal amounts of lysate were resolved on a 10% sodium dodecyl sulfate polyacrylamide gel and then transferred onto polyvinylidene fluoride membranes ...
-
bioRxiv - Cancer Biology 2020Quote: RNA-binding protein immunoprecipitation was run according to supplier recommendations (Millipore, Magna RIP Kit, 17-700). Beads were conjugated with 10 μg either anti-IMP3 (#1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration of the membrane preparation was determined by the bicinchoninic acid assay kit (Sigma-Aldrich), the sample concentration was adjusted to of 3–10 mg/mL membranes were aliquoted (50 or100 μl) ...
-
bioRxiv - Molecular Biology 2019Quote: RIP experiments were performed using a Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: RNA immunoprecipitation was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17-700; Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: RNA-binding protein immunoprecipitation (RIP) was performed using a Magna RIP kit (Cat# 17-700, Millipore) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed a RIP assay using Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Burlington, MA). HDFa were lysed in RIP lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentrations of the samples were determined by the BCA assay kit (Sigma-Aldrich, USA). Digitonin (Calbiochem ...