Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 7419 citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... washed in PBS three times and developed with 0.5% of 3,3’-diaminobenzidine (SIGMA) and 0.01% H2O2 in PB for about 15 min ...
-
bioRxiv - Bioengineering 2024Quote: ... and the cells were washed three times with PBS (Sigma-Aldrich, Darmstadt, Germany). Then ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR conditions were set up to amplify only the short 670 bp product using REDExtract-N-Amp PCR ReadyMix (Sigma). PCR conditions ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... amplified by PCR with Phusion U Hot Start PCR MasterMix (Thermo-Fischer Scientific) in presence of 0.5 mM betaine (Sigma-Aldrich) using universal bacterial primers (27F 5’ AGAGTTTGATCCTGGCTCAG and 1492R 5’ GGTTACCTTGTTACGACTT ...
-
bioRxiv - Genomics 2020Quote: ... The painting probes were generated from the DOP-PCR amplified samples by a secondary DOP-PCR incorporation of biotin-dUTP and digoxigenin-dUTP (Sigma) [25] ...
-
bioRxiv - Neuroscience 2023Quote: ... The gDNA samples were then amplified by polymerase chain reaction (PCR) using ReadyMix(TM) Taq PCR Reaction Mix (P4600,Sigma) containing 12.5μL Reaction Mix (P4600 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18bp of the reverse complement of the beginning of the DNA tag sequences was added to the 5’ of the reverse primer so that the CRM can be combined with the DNA tag in equal amount using overlap PCR (Xiong et al., 2006) using Expand High Fidelity PLUS PCR (Sigma). The resulting fragment was run on 2% agarose 1x TAE gel ...
-
bioRxiv - Microbiology 2020Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified 1,297 RT-PCR products were digested with MluI (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR products were cloned into pET21a (Novagen) using InFusion cloning technology ...
-
bioRxiv - Genomics 2020Quote: ... 1M betaine (PCR Reagent grade, Sigma-Aldrich, USA) and 0.667μM of each random primer (5’GTGAGTGATGGTTGAGGTAGTGTGGAGNNNNNTTT 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 0.5μM PCR primers (Sigma-Aldrich; S4 Table) in a Real-Time PCR Detection System CFX96 (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... and Expand high-fidelity PCR system (Sigma-Aldrich). RT-PCR products were purified on 0.7% agarose gel and subjected to Sanger sequencing (ACGT) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer pairs for PCR were from Sigma (eGFP) and Invitrogen (GAPDH) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of BioStabII PCR Enhancer (Sigma). For each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subsequent PCR was performed with primers (Sigma-Aldrich) based on the Icelandic rock ptarmigan genome and Taq DNA polymerase (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were subjected to 0.7% agarose gel analysis and the gel-purified PCR fragments were subjected to sanger sequencing (ACGT) ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR system (Sigma Aldrich). Amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were first cloned in pET22b (Novagen; containing the N-terminal pelB sequence ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Genetics 2021Quote: ... using Expand Long Template PCR System (Sigma Aldrich). PCR primers were designed using the MEIS1 promoter as a viewpoint and included Truseq adapters ...
-
A pancreas specific Ptf1a-driven Cre mouse line causes paternally transmitted germline recombinationbioRxiv - Genetics 2020Quote: ... supplemented with 10ul PCR grade Proteinase K (Sigma) at 55°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Nested PCR primers were ordered from Sigma-Aldrich’s custom oligo service ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). Amplified DNA products ...
-
bioRxiv - Cell Biology 2023Quote: ... or Expand Long Template PCR system (Roche/Sigma) and the oligonucleotides ...
-
bioRxiv - Microbiology 2023Quote: ... PCR product was cloned into vector pET28a (Novagen) and the obtained construct was used to transform E ...
-
bioRxiv - Immunology 2023Quote: ... PCR II products were then purified by Millipore MultiScreen PCR 96 plate according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... a 10μL PCR re-action mix (5.3uL Sigma Water ...
-
bioRxiv - Microbiology 2024Quote: ... PCR II products were then purified by Millipore MultiScreen PCR 96 plate according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR products were cloned into pET28 (Novagen) or pRSETA (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... tissue pieces were processed for EdU detection by incubation overnight at 4°C in PBS containing 2.5% FBS and 0.5% triton-X (Sigma-Aldrich) and then washed in PBS (x2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed with TBS-Tween (0.01% v/v) prior to detection using enhanced chemiluminescent (ECL) reagent (Millipore) and imaged using a ChemiDoc Imaging System (BioRad) ...
-
bioRxiv - Cell Biology 2019Quote: ... The proximity ligation reaction was performed according to the manufacturer’s protocol using the Duolink in situ detection orange reagents (Sigma). Images were recorded with Zeiss LSM 700 confocal microscope with a 63×/1.4 numerical aperture oil-immersion lens ...
-
bioRxiv - Plant Biology 2019Quote: Detection of Ca2+ in stomata was performed using the Fura-2 AM dye (Sigma Aldrich, CAS 108964-32-5) (Jiang et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated for 30 min with the ligation reaction containing the circularization oligos and T4 ligase prepared according to the manufacturer’s recommendations (Duolink Detection reagents Red, Sigma) in a prewarmed humidified chamber at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... We routinely used rabbit PLAplus and mouse PLAminus probes as secondary antibodies and the “Duolink Detection reagents Red” (Sigma) for ligation ...
-
bioRxiv - Neuroscience 2019Quote: We imaged these sections using secondary electron detection in a single-beam scanning electron microscope (1.7 kV; ZEISS Sigma). The acquisition was automated using WaferMapper software (Hayworth et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... RRID: AB_330924) were used at and visualized by enhanced chemiluminescence detection (Luminata Forte Western HRP Substrate; Millipore, Cat# WBWF0500). The optical density of the relevant immunoreactive bands was measured after acquisition on a ChemiDoc Touch Imaging System (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... chromogen detection was performed following incubation with biotin conjugated secondary antibodies and Extra-Avidin peroxidise (Sigma #E2886- 1:200). Sections were counterstained with hematoxylin (Vector Labs ...
-
bioRxiv - Microbiology 2020Quote: ... and the colony were stained with 3,3’-diaminobenzidine (DAB) for H2O2 detection and with 2mM Nitro Blue Tetrazolium (NBT) (Sigma) in 20mM phosphate buffer ...
-
bioRxiv - Physiology 2020Quote: ... isPLA was performed according to the manufacturer’s instructions using the Duolink In Situ Detection Reagents Red DUO92008 (Sigma-Aldrich, Olink Bioscience ...
-
bioRxiv - Plant Biology 2021Quote: ... for detection of FLS2-BAK1 co-immunoprecipitation or anti-rabbit IgG (whole molecule)–HRP (A0545, Sigma, dilution 1:10000) for all other western blots.
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit PLAplus and mouse PLAminus probes were used for secondary antibodies along with the “Duolink Detection reagents Red” (Sigma) for ligation ...
-
bioRxiv - Immunology 2022Quote: ... DENV infection was then measured by intracellular detection of the E protein using the murine monoclonal 4G2 antibody (Millipore) followed by rabbit anti-mouse IgG-coupled to AF647 (Molecular probes) ...
-
bioRxiv - Cell Biology 2022Quote: ... PLA assay was performed using custom labelled antibodies and the Duolink In Situ Detection Reagents Red (Sigma-Aldrich, DUO92008) as described by the manufacturer but with slight modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... detection was carried out by incubating the membrane with the secondary antibody goat anti-rabbit horseradish peroxidase conjugate (Sigma) diluted 1:3000 (or 1:4000 goat anti-mouse (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by western blot with the primary antibodies indicated in the figures and detection by enhanced chemiluminescence (Pierce, Millipore). Antibodies are listed in Table S5.
-
bioRxiv - Microbiology 2020Quote: ... followed by chemiluminescence detection with horseradish peroxidase-coupled secondary antibodies (1:10,000; Sigma Aldrich, or 1:5,000, Jackson ImmunoResearch).
-
bioRxiv - Pathology 2021Quote: Proximity ligation assay (PLA) was performed according to the manufacturer’s instructions (Duolink In Situ detection reagent-Red, Sigma Aldrich). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... Plates were washed and biotinylated detection antibody was added before the plates were incubated with Streptavidin peroxidase (1:1,000, Sigma) for 60 min ...