Labshake search
Citations for Millipore Sigma :
9951 - 10000 of 10000+ citations for Recombinant Human SERPINF1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Cells were pelleted and supernatant incubated with 7.5 µg precipitating antibody and 100 μL Protein A Sepharose slurry (Sigma-Aldrich, P3391) (5% w/v in lysis buffer) ...
-
bioRxiv - Neuroscience 2024Quote: ... and eluted in 30ul elution buffer (protein loading buffer [Thermo 39001] diluted to 1x, 20mM DTT [MilliporeSigma D9779], and 2mM biotin [Sigma B4639]) at 95C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... Equivalent amounts of total protein were loaded into a 12% SDS-PAGE for electrophoresis and then transferred into a PVDF membrane (Millipore, USA). After blocking nonspecific binding with 5% skimmed milk in TBST ...
-
bioRxiv - Molecular Biology 2024Quote: Promastigotes of the Leishmania braziliensis strain M2903 (MHOM/BR/75/M2903) expressing tdTomato fluorescent protein (LORENZON et al., 2022) were cultured in M199 medium (Sigma-Aldrich) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Plant Biology 2019Quote: Native and mutant versions of full-length Gα1 and C-terminal region of RGS2 and SymRKα proteins were cloned into the pET-28a vector (Novagen, Gibbstown, NJ, USA) and recombinant proteins were purified using Ni2+-affinity chromatography as previously described (Roy Choudhury et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... MultiScreen® HTS 96 multiwell plates (pore size 0.45 μm) with high protein-binding membrane (hydrophobic Immobilon-P PVDF membrane) were purchased from Millipore (Amsterdam, The Netherlands), conical 96-well Nunc plates from Thermo ...
-
bioRxiv - Genetics 2021Quote: ... Proteins were purified by Nickel-NTA resin and treated with TEV protease (1 mg lab made TEV per 40 mg of protein) and benzonase (100 units/ml, Novagen 70664-3) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... CLK2 (1:1000, sigma, HPA055366-100UL), phosphorylated SR proteins (clone 1H4, 1:500, Millipore, #MABE50. Beta-Tubulin (1:5000, Sigma Aldrich, #T7816) and Beta-Actin (1:5000 ...
-
bioRxiv - Genomics 2021Quote: RNA oligonucleotides corresponding to GAAGCAGAUGAGUAUAUG from Sod and UCAUUGGACAUAAACUGAAUUUUCCA from the gene for hypothetical protein spot A (Q9DAR0) were end labelled with γ-32P ATP and column purified using G-25 Sephadex (Sigma-Aldrich) and quantitated on a scintillation counter ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flag-tagged SecPH proteins in the cell extracts were captured with an anti-Flag M2 affinity gel (ANTI-FLAG M2 Affinity Gel, Sigma-Aldrich, A2220) by incubation on a rotating wheel at 4°C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Each protein sample was split into three aliquots (5 μg) and digested with either sequencing grade porcine trypsin (Sigma-Aldrich, MO, USA), bovine chymotrypsin ...
-
bioRxiv - Cancer Biology 2022Quote: For RNA-binding protein immunoprecipitation (RIP) ~3×107 A549 cells for each sample were processed using Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore Sigma) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5ul of experimental protein samples were loaded in duplicate into a 96-well plate along with 250ul Bradford reagent (Sigma, Cat: B6916). Absorbance was measured at 570nm using a Tecan infinite 5200 pro plate reader and iControlTM Microplate Reader Software ...
-
bioRxiv - Immunology 2021Quote: ... For RBD inoculations eight-week-old male BALB/c mice were immunized with 7.5 μg of the receptor binding domain of Spike protein (kindly gifted by Andrea Gamarnik, Argentina) in 75 μL Complete Freund’s Adjuvant (CFA, Sigma, St. Louis, MO) via subcutaneous injection and boosted 2 weeks later with 5 μg of RBD in 100 μL Incomplete Freund’s Adjuvant (IFA ...
-
bioRxiv - Cancer Biology 2019Quote: ... The total protein was dissolved by SDS-PAGE loading buffer and transferred onto poly vinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The primary antibodies (Table 3 ...
-
Glyoxal Does Not Preserve Cellular Proteins as Accurately as PFA: A Microscopical Survey of EpitopesbioRxiv - Cell Biology 2019Quote: Fixed hUC-MSCs were incubated with antibodies against some cytoskeletal proteins such as vimentin (1:50 in PBS; o/n at 4°C + 2 hr at 37°C) (Sigma; V6630, USA), pericentrin (1:1000 in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... was measured with a bicinchoninic acid (BCA) protein assay (Smith et al., 1985) using bovine serum albumin (BSA) as a standard (Sigma Chemicals, USA) with the EnVision microplate reader at an absorbance of 570 nm ...
-
bioRxiv - Cell Biology 2019Quote: ... The column was washed with KIF3A/B purification buffer and the protein was eluted in KIF3A/B purification buffer supplemented with 15 mM d-desthiobiotin (Sigma, D1411-1G). Depending on whether unlabelled or fluorescently tagged protein was needed ...
-
bioRxiv - Genetics 2019Quote: ... reactions were terminated by extraction of enzyme and other protein with one volume of TE-buffered phenol/chloroform/isoamyl alcohol mixture at pH 8.0 (Sigma Aldrich P-2069). Extracted samples were washed twice with 1 volume of ether to remove excess phenol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Immuno-fluorescence for YFP (yellow fluorescent protein) was performed on 12 µm-thick cryosections of gelatine-embedded embryos (7.5% gelatine [Sigma] in 15% sucrose) using an anti-GFP (green fluorescent protein ...
-
bioRxiv - Microbiology 2019Quote: ... For this purpose, proteins were blotted semidry (12 V, 20 min) on a PVDF membrane (PSQ membrane, 0.2 µm, Merck Millipore, Burlington, Massachusetts, USA). After incubating the membrane 5 min in 3 % TCA ...
-
bioRxiv - Synthetic Biology 2019Quote: Cells were lysed in ice-cold cell lysis buffer and equal amounts of the protein were loaded for electrophoresis on denaturing SDS/PAGE gel and then transferred onto PVDF membranes (Millipore, Billerica, MA). The blots were probed with the primary antibodies overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... Approximately 750 μg of total protein lysate per pull-down was bound to 50 μl of Flag-M2 magnetic beads (Sigma-Aldrich, USA) in binding buffer (lysis buffer but with 1%-NP-40 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... loaded sensors were equilibrated in kinetics buffer and incubated with either 5 nM or 25 nM HER2 protein (Sigma-aldrich, SRP6405-50UG). Lastly ...
-
bioRxiv - Cell Biology 2019Quote: ... Gels were then process for mass spectrometry or the proteins were transferred to the polyvinylidene difluoride membrane (Merck Millipore, Cat. No. IPVH00010) by Western Blotting (WB) ...
-
bioRxiv - Systems Biology 2020Quote: ... coli K12 whole cell lysates were analysed using 10% Mini-PROTEAN Protein Gels (4568034, Bio-Rad, Laemmli buffer S3401-VL, Sigma Aldrich). One part was stained using Coomassie Blue for total protein content (Brilliant Blue G solution ...
-
bioRxiv - Synthetic Biology 2021Quote: To induce the degradation of mAID-fused proteins, cells were treated with 500 µM indole-3-acetic acid (auxin, IAA, dissolved 500 mM in water) (Millipore Sigma, I5148) for 1 hour ...
-
bioRxiv - Biophysics 2021Quote: Wild type and p75NTR KO CGNs were trypsinized and plated at a density of 40 000 (for cell death assay) or 200 000 (for protein collection) cells per coverslip coated with poly-L-lysine (Sigma, Cat: P7280) in a 24-well (Starlab ...
-
bioRxiv - Bioengineering 2021Quote: ... Western blot analysis was performed using a primary antibody of rabbit anti-protein A (1:25,000 dilution) (Sigma-Aldrich, St. Louis, MO) and a secondary antibody of goat anti-rabbit IgG-HRP (1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... in PBS at 37°C for 30 minutes and subsequently incubated for two hours with a 1:200 concentration anti-glial fibrillary acidic protein (GFAP) antibody produced in mouse (Sigma, 1:200) and 1:500 concentration anti-β-Tubulin III antibody produced in rabbit (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... The GST-Cdc14 constructs were expressed at 16°C overnight and the protein purification followed the same procedure as for 6His-3Flag-Cdc14 using glutathione-Sepharose beads (Millipore-Sigma, 17075601) and the following buffers ...
-
bioRxiv - Plant Biology 2021Quote: Purified filaments were resuspended in SDS-PAGE sample buffer and filament proteins were subjected to SDS-PAGE on 4-20% TruPAGE Precast Gels (Sigma-Aldrich, USA). Gels were stained with Coomassie brilliant blue G-250 stain (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2020Quote: ... An efficient transfer of proteins was determined by staining a membrane with Ponceau S solution (Sigma - Aldrich, Cat No 6226-79-5). Afterwards a membrane was incubated for 1 h in a blocking buffer shaking at room temperature followed by binding with primary antibody in 5 % BSA/TBS-T buffer overnight at 4 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were used to detect the following proteins: GFP (1:200, CST, cat. # 2956,), peripherin (1:1000; Novus, cat. # NBP1-05423, NF200 (1:500, Millipore, cat # MAB5266). Primary antibodies were applied and incubated at 4 °C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... and Zbtb16 (1:250, Santa-Cruz, Mississauga, ON) Beta-actin was used as a reference protein (1:5000, Sigma-Aldrich, Oakville, ON). Blots were scanned by Amersham Imager 600 imaging system (GE Healthcare ...
-
bioRxiv - Immunology 2021Quote: Transiently expressed antibodies were purified from 30 ml of HEK 293 Expi cultures using Protein G GraviTrap columns (Sigma, GE28-9852-55) and the Ab Buffer Kit (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Protein samples were separated in 4-15% polyacrylamide gels and transferred to 0.2 µm Immobilion-PSQ transfer membrane (Millipore, Cat. No ISEQ00010) using a Bio-Rad transfer system ...
-
bioRxiv - Cancer Biology 2020Quote: Detection of an interaction between BRCA1 and the cavin or CAV1 proteins was assessed using the Duolink™ II Detection Kit (Sigma Aldrich) according to the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... Uncojugated FITC was separated from the labelled proteins using PD-10 spin columns (Sigma Aldrich, PD Spintrap™ G25, #GE28-9180-04) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... About 20 ug total proteins in each sample were fractionated by 10% SDS PAGE gel and transferred to PVDF membranes (Millipore Corporation, USA) and immunoblotted with primary antibody anti-GFP (Invitrogen-Molecular Probes ...
-
bioRxiv - Biophysics 2020Quote: ... the soluble His-tagged proteins were produced and purified after binding to a Ni-NTA His-Bind resin (Sigma-Aldrich, MO, US) as described by Martínez-Martínez (19) ...
-
bioRxiv - Cancer Biology 2021Quote: Proteins were separated using a 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels and transferred onto Immobilon-FL PVDF membrane (Millipore). The membranes were blocked in 5% BSA for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were cleared by centrifugation and 400 μg of protein lysate were incubated with 40 μL of Anti-FLAG® M2 affinity gel (Sigma, A2220) for 2 h with end-over-end rotation at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells used for total protein purification were lysed with 2 ml of a buffer containing 1% Sodium dodecyl sulfate (SDS; Sigma-Aldrich #436143), 50 mM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 15 μg of tumor protein was resolved on 12% SDS-PAGE gels and transferred to Immobilon-FL PVDF membrane (Millipore, catalog# IPFL00010). Membranes were blocked with 5% (w/v ...
-
bioRxiv - Cancer Biology 2021Quote: RIP assays were conducted to explore the relationship between lncRNA NEAT1 and miR-1299 via the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, MA, USA). Initially ...
-
bioRxiv - Cell Biology 2022Quote: ... the proteins were wet transferred onto ‘Amersham™ Protran™0.2 µm NC’ nitrocellulose membranes (GE10600002 Sigma-Aldrich Handels Gmbh, Vienna, Austria) at constant 80 V for 1,5 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... SDS-PAGE and western blot analyses were used to detect proteins and modifications using the following antibodies: anti-phospho SMAD2 (Ser465/467, Sigma, 1:500), Smad2 Polyclonal Antibody (Life Technologies 1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rinsed with PBS and the proteins were visualized with Immobilon Western Chemiluminiscent HRP substrate (Merck/Millipore, used at 1:1:3 (H2O) dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... The reporter proteins were released from the ER-localized streptavidin ‘hook’ with the addition of 40 μM biotin (Sigma-Aldrich, B4639-100MG) to the coverslip ...