Labshake search
Citations for Millipore Sigma :
9901 - 9950 of 10000+ citations for Recombinant Human SERPINF1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were then incubated overnight with primary antibodies against Yes-associated protein (YAP) (mouse monoclonal anti-YAP, 1:400, Sigma-Aldrich) at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: For cMTHFR crystallization in the R-state, purified protein (cMTHFRE21Q, L393M, V516F) underwent treatment with formaldehyde and dimethylamine-borane complex (Sigma-Aldrich) for surface lysine methylation31,32 ...
-
bioRxiv - Cell Biology 2023Quote: ... determined by BCA assay were precleared for 1 hour with Protein G Sepharose 4 Fast Flow beads (GE17-0168-01, Millipore Sigma) at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... produced in house from pAB101 hybridoma cell culture and purified on protein A Sepharose (GE)) or Ab416 (for JCPyV LT, EMD Millipore) primary antibody diluted to 0.2μg/mL in TBST for 4h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... from Barcelona (Spain) was filtered through low protein binding 0.22 µm pore size polyethersulfone (PES) membrane filters (Millex-GP, Millipore, Bedford, Massachusetts) to remove bacteria ...
-
bioRxiv - Neuroscience 2023Quote: ... the expression of truncated tau protein was induced by cultivating cells in a medium without doxycycline (Sigma-Aldrich, St. Louis, MO) for three days before cell seeding into co-culture ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant containing the phage suspensions were further filtered through low protein binding 0.22 µm pore size polyethersulfone (PES) membrane filters (Millex-GP, Millipore, Bedford, Massachusetts), diluted and plated as indicated in the previous paragraph to verify the uniformity of the plaques ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein loading was determined using a monoclonal β-actin antibody directly conjugated to horseradish peroxidase (1:20,000) from Sigma-Aldrich (A3854). Quantitation of western blot band intensity was done using Image J software.
-
bioRxiv - Bioengineering 2023Quote: ... 10 µg of protein per sample were digested in a solution containing 100mM triethylammonium bicarbonate at pH 8.5 (TEAB) (Sigma Aldrich, T7408), benzonase nuclease (Millipore Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and the indicated proteins were detected and quantified by immunoblotting with the following antibodies: rat anti-DAT (MAB369, Millipore; 1:2000), rabbit anti-TH (AB152 ...
-
bioRxiv - Plant Biology 2023Quote: The sequences encoding mature proteins were cloned into vector pET-15b with an N-terminal His6 tag sequence (Novagen, Darmstadt, Germany) (primer sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was eluted with elution buffer until resin no longer appeared yellow and concentrated to 1 mL in a 3K protein concentrator (Millipore Sigma). Concentrated protein was purified by SEC as described above.
-
bioRxiv - Bioengineering 2023Quote: We verified the patterning and the pattern transfer to PA hydrogel using green fluorescent laminin (as described in Protein patterning glass coverslips) and a pan-cadherin primary antibody (Sigma, C3678). We diluted the pan-cadherin antibody 1:200 in PBS and incubated on the devices for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-ZEB-1 (Zinc finger E-box-binding homeobox 1, Cat. #SAB3500514, from rabbit), and anti-Snail (Drosophila embryonic protein, Cat. #SAB2108482, from rabbit) were purchased from Sigma-Aldrich. Anti-EpCAM-PE (anti-epithelial cell adhesion molecule labeled with phycoerythrin ...
-
bioRxiv - Plant Biology 2024Quote: ... Calibration of the column was performed using the Gel Filtration Markers Kit for Protein Molecular Weights 12,000-200,000 Da (#MWGF200; Sigma-Aldrich/Merck, www.sigmaaldrich.com).
-
bioRxiv - Pathology 2024Quote: ... Normalised amounts of protein were reduced and alkylated with 10 mM TCEP (Thermo, #77720) and 40 mM chloroacetamide (Sigma, C0267-100G) with incubation at 55 °C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... GST tags were removed by incubating 0.70 mg of protein coupled to glutathione Sepharose 4B (Cytiva) with 20 NIH units of thrombin (Sigma-Aldrich; 10602400001) overnight at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: We determined the protein for all oxidative stress parameters according to the Coomassie blue method using the serum bovine albumin (Sigma Aldrich) as a standard ...
-
bioRxiv - Plant Biology 2024Quote: ... To quantify the concentration of purified protein in the samples a Bicinchoninic acid (BCA) assay was conducted using the BCA kit following the manufacturer recommendations (Sigma Aldrich).
-
bioRxiv - Plant Biology 2024Quote: 5 μg kinase OsDMI3-GST was incubated with 5 μg substrates (OsPrx20-His, Os Prx20T244A-His, or myelin basic protein [MBP; Sigma-Aldrich]) in kinase reaction solution for 30 min as described previously (Shen et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded onto polyacrylamide gels (8-12%) under reducing conditions and transferred to Immobilon-P membranes (EMD Millipore). After blocking with 5% BSA (wt/vol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total protein 20 ug were separated by SDS-PAGE and further transferred onto 0.2 um PVDF membrane (Millipore, Cat. No. IPVH00010) pre-soaked with ethanol ...
-
bioRxiv - Genetics 2024Quote: ... 10 µg of total protein was reduced by incubation at RT for 20 minutes with 1 µl 10 mM dithiotrytol (Sigma-Aldrich) followed by incubation for 20 minutes at RT in the dark with 1 µl 50 mM chloroacetamide (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: All variants were prepared at a concentration of 3 µM with a final concentration of 10X SYPRO Orange Protein Gel Stain (Sigma-Aldrich) in a white ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Genetics 2024Quote: ... A total protein of 800 µg was incubated overnight with 40 µL of anti-V5 agarose beads (Sigma-Aldrich, cat. #A7345). After incubation ...
-
bioRxiv - Microbiology 2024Quote: ... were electrophoresed on 10% sodium dodecyl sulphate- polyacrylamide gel and the separated proteins were transferred onto the polyvinylidene difluoride membranes (Millipore, USA) The membranes were blocked with Tris-buffered saline with Tween (TBST ...
-
bioRxiv - Physiology 2024Quote: ... and proteins were detected by Western blot using monoclonal anti-Flag M2 antibody produced in mouse (1:5000 dilution; Sigma-Aldrich), rabbit anti-FKBP12 antibody (1:1000 dilution ...
-
bioRxiv - Biophysics 2024Quote: Sf9 cells used for insect derived proteins were maintained at 1 × 106 cells/mL in Sf-900 TM II SFM supplemented with penicillin/streptomycin (Sigma-Aldrich) and fungizone (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pold1 D400A mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/uL Cas9 protein (Millipore Sigma), .6pmol/uL each crRNA (spacer sequence CCCGAGAGATGAGGTATGGG ...
-
bioRxiv - Cancer Biology 2024Quote: LSL-Pole-V411L mutant mice were generated by microinjecting into pronuclei of C57BL/6J zygotes a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul sgRNA (single guide RNA with spacer sequence AGTGGAGGCTCAAGTGGCAT (Millipore Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: Pole D272A E274A mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul each crRNA (spacer sequence AGGGAATTTGAGAGGCAGTT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were incubated with HRP-tagged secondary antibodies and protein bands were detected using ECL Prime western blotting system (Catalog No. GERPN2232, Millipore Sigma). Protein band density was measured using ImageJ 1.52a ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50 μg of protein lysate was electrophoresed on 12% SDS-polyacrylamide gels and transferred to PVDF membranes (EMD Millipore, Burlington, MA). After blocking with 5% milk ...
-
bioRxiv - Cell Biology 2024Quote: ... Horseradish peroxidase conjugated secondary antibodies (table 2) were added for 1 h at room temperature and protein signal was then visualized using Immobilon Forte (Millipore, WBLUF0500) on ImageQuant LAS 4000 or Amersham ImageQuant 800 ...
-
bioRxiv - Cancer Biology 2024Quote: Pole L424V mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul each crRNA (spacer sequence TGTGGGCAGTCATAATCTCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 30 μg of protein was separated on a 12% polyacrylamide gel and transferred onto a PVDF membrane (Immobilon-P, Millipore, IPVH00010) in a 20 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... Chromatin samples were pre-cleared with 10 µl of Magna-ChIP® protein-G magnetic beads (EMD Millipore, Cat: 16-662) pre-blocked with BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies and chromatin were mixed with 20 µl of Magna-ChIP® protein-G magnetic beads (EMD Millipore, Cat: 16-662) for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... of GST and His tagged proteins were subjected to buffer exchange using Amicon Ultra 0.5 ml 10 kDa cutoff columns (Millipore Sigma, UFC501024) with five sequential rounds of concentration performed by centrifugation at 14000 g and 4 °C for approximately 10 minutes and dilution with “EB base” (5x ...
-
bioRxiv - Genomics 2024Quote: ... The following primary antibodies are used for the first target protein at the dilutions indicated: NeuN (1:500, A60, Mouse, Millipore MAB5374), pTDP43 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1 mM NaF) and proteins were eluted by incubating the beads in TEV buffer containing TEV protease (T4455, Sigma Aldrich) overnight in 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Clone TS2/16 antibody was left incubating overnight and after that the immuno-complex was captured by adding 50μl of protein A/G agarose (Merck Sigma, Burlington, MA) beads for 2 hours at 4°C (with rolling agitation) ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 to 5 x 104 cells/cm3 for protein harvest) onto culture plates coated with 50 µg/ml Poly-D-Lysine (PDL, Sigma Aldrich) and 20 µg/ml Cultrex™ 3D-laminin (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... The pure fractions from each protein were pooled and concentrated using an Amicon 5 mL 10,000 MWCO centrifugal concentrator (Millipore Sigma, Inc.) for downstream filamentous complex formation.
-
bioRxiv - Neuroscience 2024Quote: ... The samples were then blocked in 6% donkey serum and immunolabeled for protein gene product 9.5 (PGP9.5, 1:500, Millipore-Sigma, SAB4503057-100UG) as a pan-neuronal marker or rabbit-IgG (Abcam ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein expression was induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (EMD Millipore Corp.; Cas: 367-93-1). Cells were then incubated for 18 to 20 hours at 20°C at 200 rpm ...
-
bioRxiv - Biochemistry 2024Quote: ... Equal amounts of protein samples (30 μg) were loaded per lane and submitted to electrophoresis (SDS-PAGE) in gels containing trichloroethanol (Sigma-Aldrich). Proteins were transferred into 0.2 μm nitrocellulose membranes (BioRad) ...
-
bioRxiv - Biochemistry 2024Quote: ... Gels were equilibrated in pre-chilled transfer buffer with 15% methanol and then protein was transferred to a 0.45 µm nitrocellulose membrane (Sigma catalog# 10600002) via wet electroblotting on ice for 1 h at 300 mV ...
-
bioRxiv - Biochemistry 2024Quote: Cells were harvested by centrifugation at 2000 x g for 15 minutes at RT and resuspended in Lysis Buffer (1X BugBuster® Protein Extraction Reagent (Merck-Millipore), 20 mM Tris ...