Labshake search
Citations for Millipore Sigma :
7151 - 7200 of 7654 citations for Parvovirus VP2 Recombinant Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Then 10 mg of protein per sample was separated on 12% SDS-PAGE gels (Sangon Biotech) and subsequently transferred to PVDF membrane (Millipore, Temecula) using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting techniques ...
-
bioRxiv - Molecular Biology 2023Quote: ... was diluted to 0.01 mg/mL concentration in 100 µL of 25 mM Tris/HCl buffer containing various concentrations of SAHS proteins or BSA (Sigma-Aldrich). 50 µL of each sample was stored at 4°C while the other 50 µL was dried using a Savant SPD131DDA SpeedVac (Thermo Scientific ...
-
bioRxiv - Genomics 2023Quote: ... the remaining chromatin was divided amongst separate tubes containing protein A dynabeads pre-incubated with either 2μl anti-H3K4me3 (Millipore 07-473), 10μl anti-H3K27me3 (CST 9733 ...
-
bioRxiv - Microbiology 2023Quote: ... and the flow-through containing cleaved protein was collected and concentrated to 2 mL by ultrafiltration (Amicon Ultra-15, EMD Millipore), then passed over a size exclusion column (HiLoad Superdex 200 PG ...
-
bioRxiv - Neuroscience 2023Quote: ... solubilized GluA2 or GluA2-γ2 (1 nmol) and membrane scaffold proteins (50 μL, final concentration 1 mg/mL) (MSP1E3D1, Sigma‒ Aldrich) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was incubated for 1h at 4 °C in the presence or absence of 20 or 100 µM FTY720 (Sigma-Aldrich) or fumonisin B1 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: Studies of SAMHD1-controled dynamic equilibria of dNTP concentrations (Fig. 5) were performed using a 10 mL stirred-cell pressurized protein concentrator (Amicon; EMD Millipore) assembled with a 10 kDa MWCO nitrocellulose membrane (Millipore) ...
-
bioRxiv - Biochemistry 2023Quote: Clicked and dissolved protein samples were diluted to 4 M urea with 50 mM ammonium bicarbonate (pH 8, AmBic, Sigma-Aldrich). The proteins were reduced with 4 mM DTT (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: To generate emulsions, 1 mL of fluorinated oil (Novec 7500, ACOTA) and 2 mL of protein solution (β-lactoglobulin; >90%, Sigma, from bovine milk ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were then incubated overnight with primary antibodies against Yes-associated protein (YAP) (mouse monoclonal anti-YAP, 1:400, Sigma-Aldrich) at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: For cMTHFR crystallization in the R-state, purified protein (cMTHFRE21Q, L393M, V516F) underwent treatment with formaldehyde and dimethylamine-borane complex (Sigma-Aldrich) for surface lysine methylation31,32 ...
-
bioRxiv - Cell Biology 2023Quote: ... determined by BCA assay were precleared for 1 hour with Protein G Sepharose 4 Fast Flow beads (GE17-0168-01, Millipore Sigma) at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... produced in house from pAB101 hybridoma cell culture and purified on protein A Sepharose (GE)) or Ab416 (for JCPyV LT, EMD Millipore) primary antibody diluted to 0.2μg/mL in TBST for 4h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... from Barcelona (Spain) was filtered through low protein binding 0.22 µm pore size polyethersulfone (PES) membrane filters (Millex-GP, Millipore, Bedford, Massachusetts) to remove bacteria ...
-
bioRxiv - Neuroscience 2023Quote: ... the expression of truncated tau protein was induced by cultivating cells in a medium without doxycycline (Sigma-Aldrich, St. Louis, MO) for three days before cell seeding into co-culture ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant containing the phage suspensions were further filtered through low protein binding 0.22 µm pore size polyethersulfone (PES) membrane filters (Millex-GP, Millipore, Bedford, Massachusetts), diluted and plated as indicated in the previous paragraph to verify the uniformity of the plaques ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein loading was determined using a monoclonal β-actin antibody directly conjugated to horseradish peroxidase (1:20,000) from Sigma-Aldrich (A3854). Quantitation of western blot band intensity was done using Image J software.
-
bioRxiv - Bioengineering 2023Quote: ... 10 µg of protein per sample were digested in a solution containing 100mM triethylammonium bicarbonate at pH 8.5 (TEAB) (Sigma Aldrich, T7408), benzonase nuclease (Millipore Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and the indicated proteins were detected and quantified by immunoblotting with the following antibodies: rat anti-DAT (MAB369, Millipore; 1:2000), rabbit anti-TH (AB152 ...
-
bioRxiv - Plant Biology 2023Quote: The sequences encoding mature proteins were cloned into vector pET-15b with an N-terminal His6 tag sequence (Novagen, Darmstadt, Germany) (primer sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was eluted with elution buffer until resin no longer appeared yellow and concentrated to 1 mL in a 3K protein concentrator (Millipore Sigma). Concentrated protein was purified by SEC as described above.
-
bioRxiv - Bioengineering 2023Quote: We verified the patterning and the pattern transfer to PA hydrogel using green fluorescent laminin (as described in Protein patterning glass coverslips) and a pan-cadherin primary antibody (Sigma, C3678). We diluted the pan-cadherin antibody 1:200 in PBS and incubated on the devices for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-ZEB-1 (Zinc finger E-box-binding homeobox 1, Cat. #SAB3500514, from rabbit), and anti-Snail (Drosophila embryonic protein, Cat. #SAB2108482, from rabbit) were purchased from Sigma-Aldrich. Anti-EpCAM-PE (anti-epithelial cell adhesion molecule labeled with phycoerythrin ...
-
bioRxiv - Plant Biology 2024Quote: ... Calibration of the column was performed using the Gel Filtration Markers Kit for Protein Molecular Weights 12,000-200,000 Da (#MWGF200; Sigma-Aldrich/Merck, www.sigmaaldrich.com).
-
bioRxiv - Pathology 2024Quote: ... Normalised amounts of protein were reduced and alkylated with 10 mM TCEP (Thermo, #77720) and 40 mM chloroacetamide (Sigma, C0267-100G) with incubation at 55 °C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... GST tags were removed by incubating 0.70 mg of protein coupled to glutathione Sepharose 4B (Cytiva) with 20 NIH units of thrombin (Sigma-Aldrich; 10602400001) overnight at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... No. H7379) and human hemoglobin A0 (HbA0) (with 5% (w/w) methemoglobin) (Cat. No. H0267) (all protein samples from Sigma, USA). Tetrahydrofuran (THF ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: We determined the protein for all oxidative stress parameters according to the Coomassie blue method using the serum bovine albumin (Sigma Aldrich) as a standard ...
-
bioRxiv - Plant Biology 2024Quote: ... To quantify the concentration of purified protein in the samples a Bicinchoninic acid (BCA) assay was conducted using the BCA kit following the manufacturer recommendations (Sigma Aldrich).
-
bioRxiv - Plant Biology 2024Quote: 5 μg kinase OsDMI3-GST was incubated with 5 μg substrates (OsPrx20-His, Os Prx20T244A-His, or myelin basic protein [MBP; Sigma-Aldrich]) in kinase reaction solution for 30 min as described previously (Shen et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded onto polyacrylamide gels (8-12%) under reducing conditions and transferred to Immobilon-P membranes (EMD Millipore). After blocking with 5% BSA (wt/vol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total protein 20 ug were separated by SDS-PAGE and further transferred onto 0.2 um PVDF membrane (Millipore, Cat. No. IPVH00010) pre-soaked with ethanol ...
-
bioRxiv - Genetics 2024Quote: ... 10 µg of total protein was reduced by incubation at RT for 20 minutes with 1 µl 10 mM dithiotrytol (Sigma-Aldrich) followed by incubation for 20 minutes at RT in the dark with 1 µl 50 mM chloroacetamide (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: All variants were prepared at a concentration of 3 µM with a final concentration of 10X SYPRO Orange Protein Gel Stain (Sigma-Aldrich) in a white ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Genetics 2024Quote: ... A total protein of 800 µg was incubated overnight with 40 µL of anti-V5 agarose beads (Sigma-Aldrich, cat. #A7345). After incubation ...
-
bioRxiv - Microbiology 2024Quote: ... were electrophoresed on 10% sodium dodecyl sulphate- polyacrylamide gel and the separated proteins were transferred onto the polyvinylidene difluoride membranes (Millipore, USA) The membranes were blocked with Tris-buffered saline with Tween (TBST ...
-
bioRxiv - Physiology 2024Quote: ... and proteins were detected by Western blot using monoclonal anti-Flag M2 antibody produced in mouse (1:5000 dilution; Sigma-Aldrich), rabbit anti-FKBP12 antibody (1:1000 dilution ...
-
bioRxiv - Biophysics 2024Quote: Sf9 cells used for insect derived proteins were maintained at 1 × 106 cells/mL in Sf-900 TM II SFM supplemented with penicillin/streptomycin (Sigma-Aldrich) and fungizone (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pold1 D400A mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/uL Cas9 protein (Millipore Sigma), .6pmol/uL each crRNA (spacer sequence CCCGAGAGATGAGGTATGGG ...
-
bioRxiv - Cancer Biology 2024Quote: LSL-Pole-V411L mutant mice were generated by microinjecting into pronuclei of C57BL/6J zygotes a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul sgRNA (single guide RNA with spacer sequence AGTGGAGGCTCAAGTGGCAT (Millipore Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: Pole D272A E274A mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul each crRNA (spacer sequence AGGGAATTTGAGAGGCAGTT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were incubated with HRP-tagged secondary antibodies and protein bands were detected using ECL Prime western blotting system (Catalog No. GERPN2232, Millipore Sigma). Protein band density was measured using ImageJ 1.52a ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50 μg of protein lysate was electrophoresed on 12% SDS-polyacrylamide gels and transferred to PVDF membranes (EMD Millipore, Burlington, MA). After blocking with 5% milk ...
-
bioRxiv - Cell Biology 2024Quote: ... Horseradish peroxidase conjugated secondary antibodies (table 2) were added for 1 h at room temperature and protein signal was then visualized using Immobilon Forte (Millipore, WBLUF0500) on ImageQuant LAS 4000 or Amersham ImageQuant 800 ...
-
bioRxiv - Cancer Biology 2024Quote: Pole L424V mutant mice were created by electroporation of C57BL6/J zygotes with a mixture of 50ng/ul Cas9 protein (Millipore Sigma), .6pmol/ul each crRNA (spacer sequence TGTGGGCAGTCATAATCTCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 30 μg of protein was separated on a 12% polyacrylamide gel and transferred onto a PVDF membrane (Immobilon-P, Millipore, IPVH00010) in a 20 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... Chromatin samples were pre-cleared with 10 µl of Magna-ChIP® protein-G magnetic beads (EMD Millipore, Cat: 16-662) pre-blocked with BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies and chromatin were mixed with 20 µl of Magna-ChIP® protein-G magnetic beads (EMD Millipore, Cat: 16-662) for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... of GST and His tagged proteins were subjected to buffer exchange using Amicon Ultra 0.5 ml 10 kDa cutoff columns (Millipore Sigma, UFC501024) with five sequential rounds of concentration performed by centrifugation at 14000 g and 4 °C for approximately 10 minutes and dilution with “EB base” (5x ...