Labshake search
Citations for Addgene :
301 - 350 of 908 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... the T7RNAPK276R sequence was PCR amplified from plasmid pRS315-nls-T7-RNAP (Addgene plasmid #33152) (30 ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR products were then inserted in the pJFRC4-3XUAS-IVS-mCD8::GFP (Addgene 28243) linearized by NotI ...
-
bioRxiv - Microbiology 2021Quote: ... constructed via overlap extension PCR and integrated into the vector designed by [37] (Addgene #73224), which inserts into the slr0230 site of the Synechocystis genome ...
-
bioRxiv - Cancer Biology 2020Quote: ... full length DVL2 and DVL3 PCR-fragments were amplified from 3X-FLAG-DVL2 (Addgene #24802) and XE251-pcDNA3.1 (zeo ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet was amplified by PCR from pmScarlet_alphaTubulin_C1 a gift from Dorus Gadella (Addgene plasmid #85045) (74) ...
-
bioRxiv - Plant Biology 2022Quote: ... The evolved TadA8e (Richter et al., 2020b) was PCR amplified using the ABE8e plasmid (Addgene) as template and primers ABE8-F1/R1 ...
-
bioRxiv - Cell Biology 2022Quote: ... of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888) vector backbone using primers 5’ caaacacgtacgcgtacgatgctctagaatg and 5’ tgctatgtaacgcggaactccatatatggg and the Rac1 sequence flanked Puro-GFP cassette from pN-PITCh-GFP using primers 5’ccgcgttacatagcatcgtacgcgtacgtgtttggGGCCCAGCGAGCGGCCCTGAtgaccgagtacaagcccacg and 5’cattctagagcatcgtacgcgtacgtgtttgggACCACACACTTGATGGCCTGCAtcttgtacagctcgtccatgccgag.
-
bioRxiv - Biochemistry 2022Quote: ... plasmids (Strecker et al., 2019) used in droplet digital PCR experiments were sourced from Addgene. The PSP1-targeting spacer was cloned into pHelper by Gibson assembly ...
-
bioRxiv - Neuroscience 2020Quote: ... Modified TALE constructs were created using PCR fragments amplified from pAAV-CW3SL-EGFP (Addgene # 61463), a gift from Bong-Kiun Kaang (Choi et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... mAID-mCherry was first amplified by PCR from pMK292 mAID-mCherry2-NeoR plasmid (Addgene #72830) using primers 5’- AATTGGTACCGGATCCGGTGCAGGCGCCAAG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry was PCR amplified from u-mCherry (a gift from Scott Gradia; Addgene plasmid # 29769). The polylinker sequences between ion channels and mCherry are GGSGGGSGGSGS for eSlack1/ eSlick ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... oligonucleotide pairs (Table S8) were used for PCR and inserted into pCFD5 (Addgene no. 73914) via Gibson Assembly ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were cloned into the BsmBI-digested lentiviral vector LRG2.1 (Addgene plasmid # 108098) using a Gibson Assembly® Cloning Kit (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... the TurboID fragment was amplified by PCR from the 3xHA-TurboID-NLS_pCDNA3 plasmid (Addgene #107171) with primers 8 and 9 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An EGFP coding sequence was first amplified by PCR from pLV-CS-112 (Addgene #131127) using the semi-random oligo pool SI#679 as a forward primer and another oligo pool RS#244 as a reverse primer ...
-
bioRxiv - Microbiology 2023Quote: ... GFP or human c-MET cDNA were PCR amplified from plasmid pLenti-MetGFP (Addgene #37560) and seamlessly cloned into the BamHI/XbaI sites of vector pLenti-spCas9-Blast (Addgene #52962) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were subsequently cloned pExpTol2-UAS-E1B-ReaChR-TS-tagRFP-cryaa-mCherry (Addgene #43963) digested with SpeI and PacI using Hi-Fi DNA Assembly.
-
bioRxiv - Cell Biology 2023Quote: PCR products from plasmids GFP-AHPH-WT (a gift from Michael Glotzer, Addgene plasmid # 68026) and GFP-AHPH-DM (a gift from Alpha Yap ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... The baculovirus transfer vector pFastBac HT was PCR-amplified from pFastBac HT JS-Munc18b (Addgene plasmid no ...
-
bioRxiv - Molecular Biology 2023Quote: ... mEGFP was amplified using PCR and cloned into pLgw V5-EcoDam lentiviral constructs (Addgene; 59210) using SLIC ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the Streptococcus Pyogenes dCas9GCN4 was PCR amplified from the PlatTET-gRNA2 plasmid 37 (Addgene #82559), and sub-cloned under the control of a DOX-inducible TRE-3G promoter into a PiggyBac backbone ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with one gypsy insulator element (KpnI digest, PCR with 1157A_onestep_for and 1157A_onestep_rev) and subsequently PRE-Hsp70BbCas9_1.3 (Addgene 190797) with two gypsy insulator elements (AfeI digest ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215) along with a T2A-NLS-mApple minigene for fluorescent visualization ...
-
bioRxiv - Cell Biology 2023Quote: ... the M13-encoding sequence was amplified by PCR from the plasmid pCMV CEPIA3mt (Addgene #58219) and ligated between the ER-membrane targeting sequence and the NFAST-encoding sequence in the above described ER-NFAST plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the FUS was amplified by PCR from the plasmid pHR-FUSN-mCh-Cry2WT (Addgene, #101223) with primer set #3 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: The sequence encoding Cepia3 was amplified by PCR from the plasmid pCMV CEPIA3mt (Addgene #58219) and ligated at the 3’ of the OMM-targeting sequence encoding the N-terminal 72 aminoacids of human TOM70.
-
bioRxiv - Systems Biology 2024Quote: ... coli origin of replication and ampicillin resistance gene were PCR amplified from pCRISPRyl (Addgene #70007) (Schwartz et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... inserts were PCR amplified from the epegRNA plasmids and from pCMV-PEmax (Addgene No. 174820) and inserted into the respective backbones (Addgene No ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Cas13d-NLS cassette was PCR-amplified from the pXR001_EF1a-CasRx-2A-EGFP (Addgene #109049) plasmid and cloned into pLX_TRC311-NLS-Cas13b-NES-P2A-Blast-eGFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA fragment encoding APEX2 was PCR amplified from pcDNA5/FRT/TO APEX2-GFP (Addgene) and fused to the N-terminus of DDX3X using fusion PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were cloned into the doxycycline-inducible plasmid pCW57-MCS1-2A-MCS2 (Addgene #71782), which was modified by adding bGHpolyA between the MluI and BamHI restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: The full length of IRX4_PEP1 was PCR amplified and cloned into the pDONR223 vector (Addgene) with the DYKDDDDK Flag tag by the BP recombination reaction protocol (Gateway® technology ...
-
bioRxiv - Biophysics 2023Quote: ... a linear DNA fragment was first amplified by PCR from plasmid pCDW114 (16, Addgene #70061), using primers 5′-GAAGGTCTCCAGCCGTACCAACCAGCGGCTTATC-3′ and 5′-CCGGG TCTCACCATACCCGCTGTCTGAGATTACG-3′ ...
-
bioRxiv - Biochemistry 2023Quote: ... CryC was constructed by inserting PCR amplified spTC (Addgene plasmid #153003, (Cho et al., 2020a)) onto restriction-digested Cry2-mCherry (Addgene plasmid # 26871 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_eGFP was generated by PCR amplifying the eGFP CDS from Arch(D95H)-eGFP (Addgene #51081) and inserting into pcDNA3.1(-)/myc-His A using the EcoRI and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1-GPR91 was generated by PCR amplifying the GPR91 CDS from SUCNR1-Tango (Addgene #66507) (introducing a stop codon ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Supplemental Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 7) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Molecular Biology 2024Quote: ... generated by overhang PCR as described above from AAV-CMV-GFP (Addgene plasmid # 67634; RRID:Addgene_67634) (Supplementary Table 3) ...
-
bioRxiv - Molecular Biology 2024Quote: ... generated by overhang PCR as described above from AAV-CMV-GFP (Addgene plasmid # 67634; RRID:Addgene_67634) (Supplementary Table 3) ...