Labshake search
Citations for Addgene :
551 - 600 of 908 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... CyOFP1 and mSca gene fragments were PCR amplified from pLSSmKate2-C1 (a gift from Vladislav Verkhusha; Addgene plasmid # 31869; http://n2t.net/addgene: 31869; RRID:Addgene_31869)93 ...
-
bioRxiv - Biophysics 2024Quote: ... an insert were generated by PCR using p3036 GST-HPV-16 E6 (a gift from Peter Howley (Addgene plasmid #10849 ...
-
bioRxiv - Cell Biology 2024Quote: Human mGluR6 (NP_000834.2) was PCR amplified from GRM6-Tango (45) (a gift from Bryan Roth; Addgene plasmid # 66391). To make the mGluR6-EGFP fusion ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Cancer Biology 2022Quote: ... A solution of retroviral DNA plasmids (TRI-dsRED-IDH1R132H, MSCV-GFP-DNMT3AR882H, MSCV-tTA-NrasG12D, pclEco packaging vector (Addgene plasmid cat# 12371), 0.25 M CaCl2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting PCR fragments were cloned into pJUMP27 (pJUMP27-1AsfGFP was a gift from Chris French, Addgene plasmid #126974) (45 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was digested with EcoRI and ligated into EcoRI digested pHR-SFFV-KRAB-dCas9 vector (Addgene, 60954), to generate a pHR-pTRE3G-KRAB-dCas9 vector ...
-
bioRxiv - Synthetic Biology 2021Quote: ... multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283433) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus ...
-
bioRxiv - Cell Biology 2020Quote: The gRNAscaffHygroR vector was constructed by PCR amplification of the Hygromycin resistance gene from pBABE-hygro-hTERT (Addgene # 1773) plasmid and cloning into the EGFP_SV40PA vector downstream of the OmEF1a promoter followed by the modified guide RNA scaffold sequence PCR amplified from gRNA_GFP-T2 (Addgene # 41820).
-
bioRxiv - Biochemistry 2020Quote: BsaI sites and compatible overhangs were added by PCR amplification of cpGFP from pTKEI-Mal-B2 (Addgene Plasmid #79756) using primers cpGFP-BsaI-GG-F and cpGFP-BsaI-GG-R ...
-
bioRxiv - Cell Biology 2021Quote: ... the open reading frames of mTagBFP2 and mNeongreen2 were amplified by PCR from donor vectors pBAD-mTagBFP2 (Addgene #34632) and pSFFV_mNG2(11)1-10 (Addgene #82610) ...
-
bioRxiv - Microbiology 2021Quote: ... the human ACE2 coding sequence (RefSeq accession NM_001371415.1) was PCR amplified and cloned into the BamHi site of lentiviral vector pHR-PGK (Addgene #79120). Lentivirus was produced as described above and used to transduce 5×104 target cells (A549 ...
-
bioRxiv - Systems Biology 2020Quote: ... and S415A) were introduced using the delitto perfetto method (Stuckey et al., 2011) using the PCR-amplified pCORE cassette (RRID:Addgene_72231) to integrate selective markers at the endogenous gene loci ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet-i-H2A construct was amplified by PCR from pmScarlet-i_H2A_C1 (a gift from Dorus Gadella, Addgene plasmid #85053) (Bindels et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... the EB3-tdTomato fragment was amplified by PCR from EB3-tdTomato (a gift from Erik Dent, Addgene plasmid #50708) (Merriam et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... TVA-mCherry was amplified by PCR from a plasmid (gift from Dr. Uchida, Addgene plasmid #38044 ; http://n2t.net/addgene:38044 ; RRID:Addgene_38044, ref43) and inserted into a 5xUAS vector34.
-
bioRxiv - Developmental Biology 2022Quote: ... 100µl of the ESCs were then mixed with the scCRISPR construct (Composition: 10µl elute of HDR PCR product; 1µl sgPal7 (Addgene, 71484); 1µl spCas9-BlastR (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... NTR candidates were PCR amplified and cloned into the NdeI and SalI sites of two plasmids: pUCX (Addgene #60681), for biological overexpression assays ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Biochemistry 2021Quote: pGN002: The ECFP encoding fragment was amplified by PCR using primers GNCA005 and GNCA006 (on pcDNA3-CFP, Addgene #13030), followed by DpnI treatment ...
-
bioRxiv - Cancer Biology 2021Quote: ... guide sequences were PCR amplified from a CustomArray Inc oligo pool and cloned into the lentiGuide-Puro (Addgene #52963) backbone using Golden Gate cloning ...
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... and the cDNA of CRY2PHR was PCR amplified from the pCRY2PHR-mCherryN1 plasmid from the Tucker Lab (Addgene 26866) (7) ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2021Quote: A construct encoding residues 109-492 comprising soluble TMPRSS2 ectodomain was amplified by two PCR fragments (Addgene plasmid# 53887) and subcloned into the pFHMSP-LIC C donor plasmid by LIC method ...
-
bioRxiv - Microbiology 2020Quote: ... the human ACE2 gene (Miaolingbio #P5271) was PCR-amplified and cloned into the pLV-EF1a-IRES-blast (Addgene #85133). The human TMPRSS2 and DPP4 gene (Sino Biological #HG13070-CM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Flag-hHOXA1 (pchHOXA1-3XFlag-myc) and Flag-mHoxA1 (pcmHoxa1-3XFlag-myc) were generated by cloning PCR-amplified inserts into a pcDNA3.1 vector (Addgene) featuring a 3XFlag-myc tag sequence in the multiple cloning site ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA sequence encoding the T7 RNA polymerase promoter and sgRNA was amplified by PCR from pHelper_ShCAST_sgRNA vector (Addgene, #127921). The DNA template was then subjected to GeneJet PCR purification (ThermoScientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histone H2A cDNA were PCR amplified from pCDNA3.1-Flag-H2A and pCDNA3.1-Flag-H2A K118-119R51 (Addgene, #63560, #63564). Histones Macro-H2A cDNAs were obtained for the DKFZ cDNA clone repository.
-
bioRxiv - Immunology 2022Quote: ... pTRIP-hPGK-STING-TurboID was cloned by Gibson assembly of PCR amplified TurboID from V5-TurboID-NES_pCDNA3 (Addgene #107169) and STING from pTRIP-CMV-STING-GFP ...
-
bioRxiv - Plant Biology 2022Quote: ... The LacZ selection marker was PCR amplified with flanking BsaI sites into Level 1 acceptor vector pICH41780 (Addgene #48019) to allow blue-white screening for successful gRNA insertion into final ABE vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This fragment was subcloned with the above PCR fragment using Gibson enzymatic assembly (Gibson et al. 2009) to generate PRE-Hsp70BbCas9_1.0 (Addgene 190795). Gypsy insulator elements were subsequently cloned into PRE-Hsp70BbCas9_1.0 through two Gibson cloning events to generate PRE-Hsp70BbCas9_1.2 (Addgene 190796 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragment was subcloned in the BamHI and NotI site of pET-28a+GFP-CAMSAP1 CKK (Addgene #59033), which contains 6 histidine (His ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting pU6-chiRNA cassette was amplified by PCR and inserted into the pnos-Cas9-nos plasmid (Addgene #62208) at the NheI restriction site ...
-
bioRxiv - Biochemistry 2023Quote: ... This PCR product was digested with BamHI and BsrGI and cloned into pET-21a-PEmax-6His (Addgene plasmid #204471) digested with the same enzymes ...
-
bioRxiv - Molecular Biology 2023Quote: ... the dFMRP CDS was PCR amplified from pAc5.1-EGFP-dFMRP and transferred into pET-His6-MBP-TEV (Addgene #29656) by ligation-independent cloning following QB3 Macrolab protocols (https://qb3.berkeley.edu/facility/qb3-macrolab/) ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2023Quote: ... each of these systems was PCR amplified and cloned into pTNS2 to replace the parental mini-Tn7 (Addgene #64968) by Golden Gate assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... was cloned with Gibson assembly in frame with the SV40pA sequences that were PCR amplified from lentiCRIPSRv2 (Addgene, #52961). Gibson cloning was subsequently used to simultaneously encompass digested 8xtetO-EF1a promoter-eGFP-SV40pA cassette in frame with the homology arms and the whole insert was cloned into the pSMART-HCKAN (Lucigen ...
-
bioRxiv - Biochemistry 2023Quote: ... at AgeI and NheI sites and fusing PCR amplified CIB1 and spTN (Addgene plasmid # 153002, (Cho et al., 2020a)) using Gibson assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... These sites were subsequently used to introduce the PCR product into linearized pmiRFP670-N1 plasmid (Catalog no.79987, Addgene) using T4 DNA Ligase (Catalog no ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... PCR was used to amplify the U6-crRNA scaffold and the DiCas7-11 gene sequence from pDF0114 (Addgene #172508) and pDF0159 (Addgene #172507) ...
-
bioRxiv - Bioengineering 2023Quote: ... The Sp sgRNA plasmids were obtained through PCR- site directed mutagenesis of p426- SNR52p-gRNA.CAN1.Y-SUP4t (Addgene 43803) to introduce the target sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... and then integrated into the multi-cloning site of PCR-amplified linearized pAAVS1-P-CAG-mCh (Addgene plasmid #80492), an AAVS1 targeting vector containing puromycin resistant gene ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR-amplified homology arms were cloned into the pHD-dsRed-attP reintegration vector (Addgene #51019 (Gratz et al., 2014)) and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp ...
-
bioRxiv - Neuroscience 2024Quote: The AAV vector for astrocyte-specific Cre-dependent expression of 3x HA-tagged Rpl22183 was generated by PCR amplifying the Rpl22-3xHA sequence from pZac2.1-GfaABC1D-Rpl22-HA (donated by Dr. Baljit Khakh; RRID: Addgene_111811) using primers containing NheI and AscI restriction sites 5’ and 3’ to the coding sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... and flanked by BamHI sites using PCR before insertion by In-Fusion cloning into pCFJ104 (Addgene #19328; Watertown, MA), between the body wall muscle-specific myo-3 promoter driving mCherry ...
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Microbiology 2024Quote: ... the 3xHA-TurboID coding sequence was amplified by PCR using the plasmid 3xHA-TurboID-NLS-pCDNA3 (a gift from A.Ting, Standford University, USA, Addgene #107171 [27] as a template ...