Labshake search
Citations for Addgene :
1851 - 1882 of 1882 citations for Vascular Endothelial Cell Growth Factor VEGF Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... a total of 240 million Huh7.5.1-Cas9-blast or Huh7.5.1-Cas9-blast+ACE2-IRES-TMPRSS2-hygro cells were transduced with lentivirus of the human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at a moi of 0.4 and subsequently selected using puromycin and expanded for 7 days ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Immunology 2019Quote: HEK293T cells were co-transfected with the pHR transfer plasmids with second generation packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) using Lipofectamine LTX Reagent (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... baculovirus gp64 signal sequence under control of the very late polyhedrin promoter was inserted into the insect cell vector plasmid pACEBac1 (Addgene, LGC Standards Teddington, UK) by using another synthetic gene (VK18 ...
-
bioRxiv - Molecular Biology 2020Quote: ... In the same cell line a functional cGAS was reconstituted by transducing either a lentiviral cGAS-RFP or cGAS-GFP (Addgene plasmids # 86676 and # 86675), a gift from Nicolas Manel (30) ...
-
bioRxiv - Biophysics 2020Quote: ... Lentiviruses were produced in 293T cells by transfecting lentiviruses with the helper plasmids pMD2.G and psPAX2 (a gift from D. Trono, Addgene plasmids #12259 and #12260), following Addgene’s instructions ...
-
bioRxiv - Genetics 2020Quote: Barcoded MSH2-2A-blR cDNA libraries were packaged into lentivirus by co-transfecting HEK293T/17 cells (ATCC) with the transfer plasmid pool plus envelope and packaging vectors (pMD2.G, Addgene #12259 and psPAX2, #12260). For each pool ...
-
bioRxiv - Cell Biology 2021Quote: ... and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Microbiology 2020Quote: Lentiviruses derived from pLKO or pGIPZ were derived from transfection of 293T cells with packaging plasmids pMD2.G and psPAX2 (gifts from Didier Trono Addgene plasmids 12259 and 12260) using polyethylenimine MAX (polysciences #24765) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lentiviral particles were then prepared by cotransfection of pLentiCRISPRv2 constructs into HEK293T cells with pCMV-VSV-G (Addgene #8454, a gift from Bob Weinberg) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viral supernatants were prepared by transfection of HEK293T cells with the vector plasmids and packaging plasmids (psPAX2 Addgene 12259 and pMD2.G Addgene 12260). The transfection was performed with polyethylenimine (PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride ...
-
bioRxiv - Microbiology 2022Quote: ... Dimeric human ACE2-IgG1 (hACE2) was generated by transfecting Expi293 cells with pcDNA3-sACE2-WT(732)-IgG129 (Addgene plasmid #154104, gift from Erik Procko) using 1 mg mL-1 PEI and then purifying from the supernatant five days post-transfection using rProtein A Sepharose (GE ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviruses were generated in HEK293T cells by transient expression of the indicated shRNA vectors below with psPAX2 and pMD2.G packaging vectors (Addgene plasmids 11260 and 12259). For lentiviral production in 96 well plates ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus was produced in 293T cells by co-transfecting NF-κB reporter (41) with packaging vectors psPAX2 (Addgene #12260, a gift from Didier Trono) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviruses were generated in HEK293T cells by transient expression of the vectors with pSPAX2 and pMD2.G packaging vectors (Addgene plasmids #12260 and #12259). Viral supernatants were collected after 48 h of expression and passed through a 45 μm syringe filter before exposure to target cells.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were generated by transfecting sub-confluent HEK293T cells along with the lentiviral vector and packaging vectors pCMV-VSV-G (Addgene, Cat. 8454, RRID: Addgene_8454) and psPAX2 (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Ishikawa cells were plated at a density of ~300,000 cells per well in 6 well plates and transfected the following day with 1650 ng Cas9 plasmid (Addgene 62988, a gift from Feng Zhang), 550 ng of each guide RNA (Table S2) ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Immunology 2019Quote: ... Cas9-expressing recipient-cells either iCasp1−/−/Casp11−/− or iNlrc4−/− (1,000,000 cells/well in 6-well plates) were generated by lentiviral transduction with Cas9-expressing lentiviral vector (lentiCas9-Blast, Addgene 52962, from Feng Zhang lab) and then infected with the lenti-Guide viral particles in presence of 8μg/ml polybrene and centrifugated for 2 h at 2900 rpm at 32°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Nalm6 and BL2 cells were performed by lentiviral delivery of Cas9 and the sgRNA using the lentiCRISPR v2 backbone (#52961 – Addgene; a gift from Feng Zhang) (58) ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Systems Biology 2022Quote: ... a total of 240 million A549-Cas9 cells were transduced with the lentivirus of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) (48 ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Genetics 2019Quote: ... PRDM9 with a C-terminal V5 or N-terminal YFP tag for expression in mammalian cells (pLENTI CMV/TO Puro DEST backbone vector, Addgene plasmid # 17293; Campeau et al., 2009) were described previously (Altemose et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Microbiology 2022Quote: All lentiviruses vector particles were generated in HEK-293T cells by co-transfection with plasmids pMD2.g and psPAX2 (Addgene # 12259, #12260, gift of Didier Trono), exactly as described previously (43) ...
-
bioRxiv - Cell Biology 2024Quote: To generate RRBP1 KO HEK293T cells expressing EGFP-FLAG-APEX2-ePTS1 single gRNA transcriptional cassette prepared by PCR and pCAS9-mCherry empty (Addgene, 80975 (Schmid- Burgk et al., 2016)) were co-transfected into HEK293T cells expressing EGFP-FLAG-APEX2- ePTS1 ...
-
bioRxiv - Microbiology 2023Quote: ... We first generated a CRISPRi cell line by transducing J-Lat A72 with the vector lenti-EF1a-dCas9-KRAB-Puro (Addgene #99372, a gift from Kristen Brennand). After selecting with puromycin-containing media (1 μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 µg lentiviral plasmid pLV-ER-GFP (Addgene, 80069, a gift from Pantelis Tsoulfas), 8 µg pCMV-dR8.91 ...
-
bioRxiv - Cell Biology 2019Quote: Wild-type or SURF4-deficient HEK293T cells that stably express EPO-eGFP and A1AT-mCherry were transfected with a plasmid expressing ERoxBFP (Addgene: 68126, a gift from Erik Snapp (99)) ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...