Labshake search
Citations for Addgene :
1451 - 1500 of 1882 citations for Vascular Endothelial Cell Growth Factor VEGF Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: The following plasmids were used for the transfection of cultured cells: pMXs-IP-EGFP-LC3 (Hara et al., 2008) (gift from Noboru Mizushima; Addgene plasmid no ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962, a gift from Feng Zhang). sgRNAs targeting NKX2-1 or SOX1 were selected from Brunello library (Table E2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Stable CHO cell lines expressing CRT-GFP or CRT(Y108F)-GFP were obtained by co-transfection with pBABE-puro (Addgene) and selection with puromycin.
-
bioRxiv - Immunology 2022Quote: ... Lentiviral particles were produced in 293T cells using pMD2.G and psPAX2 (from Didier Trono, Addgene plasmids #12259 and #12260), and pINDUCER-21 p.M694V Pyrin ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Lifeact (Riedl et al., 2008) were transduced with viral supernatant obtained from HEK293T cells co-transfected with pCMVR8.2 (Addgene #12263) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2022Quote: ... lentivirus-like particles were made by transfecting HEK293T cells with the plasmids psPAX2 (gift from Didier Trono, Addgene plasmid # 12260), pMD2.G (gift from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vector lentiCRISPRv2 carrying both Cas9 enzyme and a gRNA transfected into HEK293T cells together with the packaging plasmids psPAX2 and pCMV-VSV-G (Addgene) at the ratio of 5:3:2 ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were co-transfected with a single gRNA and pCAS9-mCherry empty (Addgene, 80975 (Schmid-Burgk et al., 2016)) using TransIT-2020 (Mirus ...
-
bioRxiv - Molecular Biology 2024Quote: Lentiviruses were produced in HEK293FT cells cultured in T225 flasks by cotransfection of 30μg of packaging plasmid (psPAX2, Addgene #12260), 30 μg of envelope plasmid (VSV-G ...
-
bioRxiv - Microbiology 2024Quote: ... Lentivirus were produced by transfection of 293T cells with pCMV-VSV-G (a gift from Bob Weinberg, Addgene plasmid #8454), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with a mixture of pSpCas9(BB)-2A-GFP plasmids (gift from Feng Zhang; Addgene plasmid #48138) containing two different sgRNA sequences (TTGGATGACTCGGACTCGCT and CGCTTGGTGATTCCATGTAA ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
bioRxiv - Genetics 2023Quote: ... 1 × 106 iPS cells were seeded at a density of 100,000 cells/cm2 and transfected with 3 μg pC13N-dCas9-BFP-KRAB (Addgene, 127968), 0.375 μg pZT-C13-L1 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... coli MG-1655 cells harboring the pEB1-mGFPmut2 plasmid where used throughout the study (pEB1-mGFPmut2 was a gift from Philippe Cluzel, Addgene plasmid #103980 ...
-
bioRxiv - Microbiology 2024Quote: ... 10cm cell culture grade petri dishes of approximately 80% confluent 293T cells were transfected with 1.4μg pMD2.G (VSV-G envelope expressing plasmid, a gift from Didier Trono (Addgene plasmid #12259), 3.6μg psPAX2 (Gag-Pol expression construct ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Cell Biology 2023Quote: Replication-deficient lentiviral particles were produced by CaCl2-transfection of 293-T cells with the packaging vector psPAX2 (Addgene, #12260), the envelope vector pMD2.G (Addgene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Yeast cells were transformed following a modified lithium acetate transformation protocol 157 with a pCAS-NAT or pCAS-HPH plasmid (Addgene plasmid 6084747 modified by 159 and 160 using the same approach as in 161 ...
-
bioRxiv - Immunology 2023Quote: Retrovirus were packaged by co-transfection of Phoenix-Eco cells with indicated plasmid and helper plasmid pCL-Eco (Addgene #12371) using calcium phosphate precipitate mediated transfection ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with pLenti-CRISPRv2 plasmids and the packaging plasmids pPAX2 (Addgene #12260, deposited by Didier Trono) and pMD2.G (Addgene #12559 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... pEF and minCMV promoter reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate donor constructs (pEF promoter: Addgene #161927 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-6×105 cells in a 35 mM well were transfected with 0.4ug of DNA encoding a puro resistance plasmid (pCoPURO, Addgene #17533) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: A549-AT cells were seeded in a 96-well format and were transfected with 0.1 ng of pRL-SV40 (Addgene; #27163) together with either 0.1 μg M50 Super 8x TOPFlash (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293T-ACE2 were obtained by infecting the cells with a 2nd generation lentiviral vector with pHR-PGK_hACE2 (Addgene plasmid #161612) as a transfer vector ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: SH-SY5Y cells were plated in 6-well plates at a density of 400,000 cells per well and transfected the following day with pEGFP-n1-APP (69924, Addgene plasmid) using the jetOPTIMUS transfection reagent (Polyplus ...
-
bioRxiv - Microbiology 2023Quote: HMGB1 plasmids for cell line construction were generated in a 2nd generation pLVX-M- puro transfer plasmid (Addgene plasmid# 125839). The HMGB1 sequence was obtained from the pcDNA3.1 Flag hHMGB1 plasmid (Addgene plasmid #31609).
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with an I-SceI rare cutter endonuclease coding plasmid construct (cat #26477, Addgene Watertown, Massachusetts, USA). After 96 h of gene silencing ...
-
bioRxiv - Biochemistry 2023Quote: Phosphorylated tauC3 was expressed in Sf9 insect cells from a 438B pFastBac vector containing an engineered 6xHis tag and a TEV protease cleavage site (Addgene). Following two rounds of virus amplification ...
-
bioRxiv - Cell Biology 2023Quote: Cas9-expressing HAP1 cells were generated by low multiplicity of infection transduction with lentivirus generated from lentiCas9-Blast74 (Addgene 52962) as described in the preceding paragraph ...
-
bioRxiv - Cell Biology 2023Quote: After production of recombinant lentiviruses in HEK293T cells by co-transfection of the pLentiCRISPRv2 constructs with pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Bioengineering 2023Quote: ... The AQP1-miniIAA7 and AQP1-AID expressing cell lines were transduced a second time with lentivirus encoding AtAFB2 (Addgene 129718) and OsTIR1 (Addgene 72834 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5X106 purified T cells were electroporated (program U-14) in presence of the pT4.iC9.79D vector and the transposase SB100X plasmid (Addgene 34879) or of the transposase SB100X mRNA ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus particles were produced in the packaging cell line HEK293T using packaging vectors psPAX2 and pMD2.G (both from Addgene). Plasmids were transfected with polyethyleneimine (PEI ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ARPE19 cells were either transfected with EGFP-AKT2 or HA-SIRT5 or EGFP-AKT2 (K14A/R25E) (86593; 24483; 86595, Addgene) constructs using a Lipofectamine transfection kit (L3000008 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... pAP1σ1-RFP (for expression of fluorescently-tagged APα1 in human cells) was cloned by Gibson assembly using sequences derived from pAP1α1-eGFP (Addgene plasmid 53611) and pTagRFP-RAB2A (provided by S ...
-
bioRxiv - Genomics 2023Quote: ... 2.106 SOX2-P2A-tagBFP cells were transfected with 50nM of plasmid expressing either miRFP670 (a gift from Vladislav Verkhusha; Addgene plasmid #79987 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... coli competent cells were transformed by heat shock with a vector pETM33_Nsp5_Mpro (a gift from Ylva Ivarsson; Addgene plasmid # 156475). Bacteria were cultured on LB medium with kanamycin [50 ug/ml] ...
-
bioRxiv - Microbiology 2023Quote: ... J-Lat A72 CRISPRi cells were transduced with the lentiviral vector pLKO5.sgRNA.EFS.tRFP (Addgene #57823, a gift from Benjamin Ebert), containing target-specific sgRNAs (J-Lat A72 CRISPRi CD73KD ...
-
bioRxiv - Genetics 2023Quote: ... it was expanded and 100 million cells were infected with a BFP-expressing gRNA lentiviral library (Addgene Pooled Library #67988) at an infection rate of 25-30% to keep the Multiplicity of Infection (MOI ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate DOX inducible METTL3-KD cells in ALT+ NB METTL3- sh1 sequences were cloned in the Tet-pLKO-puro vector (21915, Addgene). As a control for inducible shRNA KD ...
-
bioRxiv - Biochemistry 2022Quote: ... the induced cells were made electrocompetent and subsequently co-transformed with pBEL2108 (a derivative of payload plasmid pKM468 (Addgene #108434)37 containing a 3C protease cleavage site upstream of the eGFP tag ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells (Cat.# ACC635; DSMZ, Braunschweig, Germany) with Pmd2 (AddGene, Plasmid #12259), lentiviral envelope plasmid psPAX2 (AddGene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ptch;p53 primary cell-line(#4954) was transduced using viral particles containing the lentiCas9-Blast vector (Addgene, Watertown, MA; RRID:Addgene_52962). Cells stably expressing Cas9 were selected using 10ug/ml Blasticidin S HCl (Gibco™-#R21001) ...
-
bioRxiv - Cancer Biology 2023Quote: The murine ID8-gTRP53-gBRCA1-Cas9 cell line was generated by co-transfecting a lentiviral Cas9-Blast vector (Addgene #52962) with the packaging plasmids pCMV-dR8.91 and pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Systems Biology 2022Quote: ... Lentivirus expressing GFP was produced by co-transfection of HEK293ft cells with the following plasmids: plenti-CMV-Puro-DEST (Addgene #17452 ...
-
bioRxiv - Biochemistry 2023Quote: Mass spectrometry sample preparation: N2A cells were transfected with pcDNA3 plasmids containing 2X myc-EXOSC3 or pcDNA3 empty vector (Addgene) using Lipofectamine® 2000 (Thermofisher ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells by transfecting a 10 cm plate with 15 µg packaging plasmid psPAX2(Addgene), 5 µg envelope plasmid pMD2.G (Addgene) ...