Labshake search
Citations for Addgene :
1601 - 1650 of 1882 citations for Vascular Endothelial Cell Growth Factor VEGF Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...
-
bioRxiv - Cell Biology 2020Quote: HAP1 wt cells as well as single cell-derived clones were obtained from Haplogen Genomics or generated in-house by transient transfection with px459 (Addgene #48139) vectors carrying sgRNAs against the selected genes ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2021Quote: ... Lig4-/-:53bp1-/- and Lig4-/-:53bp1-/- cell lines were made by transiently transfecting 53bp1 or Lin37 guide RNAs (gRNAs) in the pX330 vector (Addgene# 42230) into WT or Lig4-/- cells followed by subcloning by limited dilution ...
-
bioRxiv - Physiology 2021Quote: A549 cells (NCI-DTP Cat# A549, RRID:CVCL_0023) were identically transfected with GFP-eNOS (provided by W. Sessa, Addgene plasmid #22444; RRID:Addgene_22444) and/or mCherry-HSP90 (provided by D ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentivirus was produced by co-transfection of HEK293T cells with a lentiviral vector and the packaging plasmids psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Microbiology 2020Quote: ... A549-ACE2-Cas9 cells were generated by transduction of A549-ACE2 cell line with a packaged lentivirus expressing the mCherry derived from the lentiCas9-Blast (Addgene #52962) that the blasticidin resistance gene was replaced by mCherry ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 Tet on cells were generated by transduction of Huh-7 cells with lentivirus generated using the pCW57.1 plasmid (gift from David Root, Addgene plasmid # 41393).
-
bioRxiv - Immunology 2021Quote: ... LentiGuide-Puro empty vector (control) or SP140 gRNA cloned plasmids were then co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12260 ...
-
bioRxiv - Cell Biology 2021Quote: ATM KO HMC3 cells were generated using a vector encoding SpCas9(D10A) nickase (kind gift of Feng Zhang; Addgene plasmid #48141) (65 ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 CRISPR/Cas9 edited cell lines were generated by first isolating clones with doxycycline-inducible expression of Cas9 (Addgene, 50661), then infected with lentivirus harboring the sgRNA and selected with 4 μg/ml blasticidin ...
-
bioRxiv - Cell Biology 2021Quote: ... To generate Ftractin-mCherry stable STIM1-10A and WT MEFs, cells were infected with lentivirus expressing Ftractin-mCherry (Hayer et al., 2016) (Addgene #85131). The plasmid pLenti-EB1-EGFP was obtained from Addgene (plasmid # 118084) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-mediated knockdown of CCL5 and CXCL10 in the dMMR MC38 cells was achieved using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Stably knocked down cells were selected with 250 ug/ml hygromycin and knockdown was confirmed by Western blot.
-
bioRxiv - Microbiology 2020Quote: ... cDNA used to generate ACE2 positive cells was constructed as follows: the ACE2 PmeI cDNA fragment obtained from the plasmid hACE2 (Addgene; #1786) was cloned in pMD2iPuror opened in EcoRV.
-
bioRxiv - Cancer Biology 2022Quote: MCF10A MND1 and PSMC3IP CRISPRi cell lines were generated by cloning sgRNAs into the BbsI site of the pKLV5-U6sgRNA5-PGKPuroBFP (Addgene # 50946), as previously described (Tzelepis et al. ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus preps were produced in 293FT cells transfected with lentiviral delivery vectors together with second generation packaging system consisting of psPax2 (Addgene 12260), and pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2022Quote: All lentiviral productions were done by transfecting 293T cells with equal amount of lentiviral packaging combo (pMDLg/pRRE (Addgene Plasmid #12251), pRSV-Rev (Addgene Plasmid #12253) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viral supernatants were prepared by transfection of HEK293T cells with the vector plasmids and packaging plasmids (psPAX2 Addgene 12259 and pMD2.G Addgene 12260). The transfection was performed with polyethylenimine (PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lenti-vectors expressing each pair of gRNAs targeting distal enhancers were packaged in 293T cells using pMD2.G (Addgene # 12259) and psPAX (Addgene # 12260) ...
-
bioRxiv - Biochemistry 2022Quote: ... lentivirus was produced by co-transfection of HEK293T cells with a lentiviral vector and the packaging plasmids psPAX2 (Addgene, plasmid #12260) and pMD.2G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell line used for CRISPRi screen was generated by lentiviral transduction of MCF10A TP53-/- cells with lenti-BLAST-dCas9-KRAB (Addgene, #89567) followed by selection with 10 μg/mL blasticidin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9-expressing cells were generated as follows: each parental cell line was incubated with lentivirus corresponding to the pLX_311-Cas9 plasmid (Addgene plasmid #96924), encoding the Cas9 protein ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1.iPLK4 and RPE-1.iPLK41-608 cell lines were generated using pLenti-CMV-TetR-Blast lentiviral vector (Addgene, 17492) and selected using Blasticidin (10 µg/mL) ...
-
bioRxiv - Genomics 2022Quote: ... Viral particles were produced by transient transfection of HEK293T cells with the library and packaging plasmids pMD2.G (Addgene no. 12259) as well as psPAX2 (Addgene no ...
-
bioRxiv - Microbiology 2022Quote: ... in DMEM+10% FBS supplemented with 20 μg/ml G418 to select for transduced cells.Selection was repeated for 6 passages and selected cells were expanded into 24 well plates and transfected with pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230; Addgene, Watertown, MA) by Trans IT LT-1 (Mirus Bio ...
-
bioRxiv - Systems Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Neuroscience 2023Quote: ... pLVX-UbC-rtTA-Htt-Q94-CFP vector was co-transfected in HEK293T cells using Lipofectamine2000 with packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Spike protein pseudotyped luciferase-expressing lentivirus preparation, HEK293T cells were transfected with FUW-RLuc-T2A-PuroR(Kanarek et al., 2018) (Addgene, MA), psPAX2 and pUNO1-SARS2-S (D614G ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles for cas9 and HSP90-alpha were produced using HEK293T cells by con-transfection of transgene plasmid and pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Microbiology 2023Quote: ... Puromycin selection was performed until visual inspection showed a pure population of cells express zsGreen (which is part of lentivirus backbone, see plasmid Addgene #204579). At this point all cell stored libraries were frozen until further use.
-
bioRxiv - Physiology 2024Quote: ... Pparg1 or Pparg2 in NIH-3T3 cells was performed by transfecting pcDNA3.1(-) rat C/EBP alpha (#12550, Addgene, Watertown, MA, USA), pcDNA-mC/EBPb (#49198 ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Molecular Biology 2024Quote: ... To generate MPST-/- HeLa cells single guide RNAs (sgRNAs) against MPST (fwd: CACCGGCGTCGTAGATCACGACGT, rev: AAACACGTCGTGATCTACGACGCC) were subcloned into the plentiCRISPR V1 (Addgene 52963). Subcloned plasmids were co-transfected into HEK293T cells with lentiviral packaging vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Cell Biology 2024Quote: ... hTERT-RPE1 cells were edited to create a functionally null puromycin resistance cassette through delivery of two pX461 vectors (Addgene #48140) containing the appropriate guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...
-
bioRxiv - Neuroscience 2024Quote: iPS cells were transduced with a Lentivirus expressing GFP under activation of WNT signaling (Lentiviral-Top-dGFP reporter, Addgene plasmid #14715). Puromycin (1μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... MP5-Hif1α KO lines were made via transducing MP5 cells with sgHif1a or sgNT cloned into lentiCRISPRv2-GFP (Addgene, plasmid #82416) and sorting for GFP.
-
bioRxiv - Genomics 2024Quote: ... we nucleofected five million cells with five µg of spCas9/sgRNA-expression plasmids (pX330-U6-Chimeric-BB-CBh-hSpCas9, Addgene #42230) by Nucleofector 2b ...
-
bioRxiv - Cell Biology 2024Quote: ... MEFs and MDA-MB-231 cells were stably modified using BFP and DN-KASH expression plasmids in a doxycycline-inducible Piggybac plasmid backbone (Addgene #187019). For lentiviral modifications ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260, Addgene, USA), pMD2.G (# 12259 ...