Labshake search
Citations for Addgene :
1351 - 1400 of 1882 citations for Vascular Endothelial Cell Growth Factor VEGF Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293/T17 cells were transfected with DNAJB1-PRKACA K128H plasmid along with psPAX2 (Addgene plasmid #12260, gift from Didier Trono) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2019Quote: ... we selected a BRD2-expressing stable ARPE19 cell line using a lentivector constructed based on an empty vector (Addgene, 19319).
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transfected using a calcium phosphate protocol with plasmids psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260), pCAG-Eco (a gift from Arthur Nienhuis & Patrick Salmon ...
-
bioRxiv - Genetics 2021Quote: ... Pools of PiggyBac cargo plasmids that can be used to make peCHYRON cell lines will be made available from Addgene. All plasmids to be used for transfection were purified with HP GenElute Midi or Mini kits (Sigma # NA0200 and NA0150).
-
bioRxiv - Genetics 2021Quote: ... K562 cells endogenously expressing BE4 and FNLS were generated by infecting K562 cells with a lentiviral vector carrying a base editor and puromycin resistance genes (pLenti-BE4GamRA-P2A-Puro, Addgene 112673 ...
-
bioRxiv - Cell Biology 2021Quote: ... The HeLa GFP-RAB7 line was generated by transfecting HeLa cells (ATCC) with the donor plasmid pDONOR-GFP-RAB7 and pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) bearing the appropriate targeting sequence (5’-TAGTTTGAAGGATGACCTCT-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... ACTB repair template AICSDP-15: ACTB-mEGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid # 87425). SOX9 repair template was created by Infusion (638909 ...
-
bioRxiv - Genomics 2021Quote: ... cells constitutively expressing dCas9KRAB were transduced with a library of gRNAs cloned into the CROP-seq-opti vector (Addgene #106280) in order to capture gRNA information on the 10X platform ...
-
bioRxiv - Cancer Biology 2020Quote: EKVX cells (4×105) were plated in 6-well plates and were transfected with 3μg of linearized lentiCas9-Blast (Addgene, 52962) using lipofectamine 2000 (11-668-019 ...
-
bioRxiv - Bioengineering 2021Quote: ... Lentiviral particles were made by transfecting HEK293T cells with the plasmid of interest and with packaging plasmids (3rd generation Lentiviral system from Addgene). Replication incompetent virus was collected using a BL2+ safety protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus to express Cre recombinase was produced by transfecting NIH HEK293T cells with Cre-IRES-PuroR plasmid (Addgene plasmid #30205), Δ8.9 and VSV-G ...
-
bioRxiv - Cancer Biology 2020Quote: ... and lentiviral particles for sgRNA were produced in HEK293T cells by co-transfecting pLXsgRNA plasmid with pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260).(Supplementary table 2a ...
-
bioRxiv - Cancer Biology 2019Quote: Lentiviruses were prepared in human embryonic kidney 293T cells (ATCC) by triple transfection of the viral vector with psPAX2 + pMD.2G (Addgene) and transduced into MCF10A-5E ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Expi293F cells were transfected with pcDNA3-SARS-CoV-2-S-RBD-sfGFP (a gift from Erik Procko, Addgene plasmid # 141184) using ExpiFectamine™ 293 Transfection Kit according to manufacturer’s directions (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293FT cells were transfected with one of the three destination vectors plus a lentiviral packaging vector (psPAX2, Addgene plasmid #12260) and a VSV-G envelope expressing vector (pMD2.G ...
-
bioRxiv - Microbiology 2021Quote: ... A549 PAF1 and STAT2 rescue cells were created by cloning PAF1 and STAT2 cDNA into pLenti6 plasmid (Addgene #89766, 54). Lentiviral packaging was performed as described above ...
-
bioRxiv - Biochemistry 2021Quote: ... bacterial cells were co-transformed with the SDC-containing plasmid and pULTRA-CNF (Addgene # 48215, a gift from Peter Schultz) [14] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MBD2 KO and MBD3 KO cell lines were generated by co-transfecting pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) with two sgRNA targeting exon 1 for MBD2 KO cell line (sg1_GACTCCGCCATAGAGCAGGG ...
-
bioRxiv - Microbiology 2021Quote: ... lentiviruses were produced in HEK293T cells by co-transfection of library plasmids together with the packaging plasmid psPAX2 (Addgene 12260) and envelope plasmid pMD2.G (Addgene 12259) ...
-
bioRxiv - Systems Biology 2021Quote: U2OS cells stably expressing a membrane-targeted form of eGFP were generated by transfection with plasmid Lck-GFP (Addgene #610992) and culturing in selection medium (DMEM medium containing 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: BHK21-Cas13b cell line was transduced with lentivirus carrying TRE-mCherry reporter cassette (generated from pLV-tetO-mCherry, Addgene #70273). The transduced cells were sorted for mCherry+ cells ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... and after selection in 300 μg/ml G418 cells were tagged with luciferase by transduction with lentiviruses expressing pFU-Luc2-eGFP (Addgene).
-
bioRxiv - Cancer Biology 2020Quote: To evaluate the NF-κB activity in the presence or absence of AF10 FPs iCALM-AF10 or iMLL-AF10 AML cells were transduced with lentivirus expressing NFkB-TA-Luc-UBC-GFP-W (Addgene plasmid 49343 ...
-
bioRxiv - Cell Biology 2021Quote: Rhodopsin protein was expressed in HEK293 cells using transient transfection (pcDNA3 rod opsin construct, a gift from Robert Lucas (Addgene plasmid # 109361 ...
-
bioRxiv - Biophysics 2020Quote: Murine sarcoma S-180 cells were stably transfected with plasmid construct encoding for F-TRActin-EGFP (Addgene® Plasmid #58473). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lines for use in orthotopic in vivo experiments were labeled with pLenti-PGK-V5-LUC Neo (Addgene plasmid #21471). The 293 cells were seeded in 10-cm-diameter dishes and transfected with pCMV-dR8.2 dvpr (Addgene plasmid #8455) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2003)) or pCL-ECO for fetal liver cells (Addgene plasmid #12371; http://n2t.net/addgene:12371; RRID:Addgene_12371 (Naviaux et al., 1996)) ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 cyclinB1-Venus/tubulin-mRFP cell line was generated in our lab by transduction with lentiviral vectors containing tubulin-mRFP (Addgene). RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene) ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Molecular Biology 2022Quote: SVF cells were isolated as above and on the same day a confluent 10 cm dish of 293T cells were transfected with 1.5 µg psPAX2 lentiviral packaging vector (Addgene 12260), 1.5 µg pMD2.G envelop plasmid (Addgene ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: HEK293 cells were transfected in 96-well plates with the 8xGTIIC-luciferase plasmid (firefly luciferase, # 34615, Addgene, Watertown, MA, US) and the pRL-SVl40P plasmid (Renilla luciferase ...
-
bioRxiv - Neuroscience 2022Quote: ... For the preparation of high-titer lentiviral stock lentiviral particles were produced in HEK293T cells by transiently co-transfecting the described plasmids with psPAX2 (#12260, Addgene) and pCMV-VSV-G (#8454 ...
-
bioRxiv - Neuroscience 2022Quote: For HEK-cell expression, mutations were introduced in previously described ACR constructs of GtACR1 (Wietek et al., 2016) (Addgene #85464) and PhobosCA (Wietek et al. ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Cancer Biology 2022Quote: MLH1 KO cell line clones were generated by transient transfection of a Cas9-T2A-EGFP expression plasmid (Addgene Plasmid #48140), with co-expression of an MLH1-targeting gRNA (5’-GCACATCGAGAGCAAGCTCC-3’) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and each plasmid was packaged separately in 293T cells via co-transfection with polyethylenimine alongside pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Microbiology 2021Quote: ... HEK 293T cells in 10cm dishes were transfected at 80% confluency with the lentiviral plasmid pLenti-CMV-Puro (Addgene #17452) containing the gene of interest (2 μg) ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Microbiology 2021Quote: HeLa cells were seeded onto glass coverslips and transfected with either myc-ACE2 (pCEP4-myc-ACE2 from Addgene Plasmid #141185), ACE2 (Daly et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The empty ctrl or MMP14-eGFP lentiviral plasmid (7.5 μg) was co-transfected into 293 cells with packaging plasmid pRSV-Rev (5 μg, Addgene #12253), pMDLg/pRRE (2.5 μg ...
-
bioRxiv - Genetics 2022Quote: Cilia-APEX-IMCD3 cells were transfected with 4µg of base editing plasmid BE4-Gam (Plasmid #100806, Addgene, Watertown, Massachusetts, USA) and 1 µg of BPK1520 with respective gRNA insert using jet prime transfection reagent (Polyplus-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... SK-N-DZ cells expressing dCas9-VP64 were transduced with lentiviral particles encoding the p65-HSF1 transactivator complex (pLentiMPH2, Addgene plasmid #89308 was a gift from Feng Zhang) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were produced in HEK293T cells by transfection with 0.2 µg of pCMV-VSV-G (Addgene, #8454, MA, USA), 2 µg of psPAX2 (Addgene ...