Labshake search
Citations for Addgene :
1501 - 1550 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Genomics 2023Quote: ... we designed a gRNA that targets the 3’ end of the SOX2 stop codon (Supplementary Table S25, Addgene plasmid #163752). We then amplified ∼800 bp homology arms upstream and downstream of the gRNA target sequence using high-fidelity Phusion Polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Cell Biology 2023Quote: eGFP with three perfect miR430 target sites in its 3’UTR (eGFP-3xPT-miR430b) was inserted in the pCS2+ plasmid (Addgene) as described before 24 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi clone that targets the 3’UTR of cdc-42 was generated through amplification of genomic cdc-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Neuroscience 2024Quote: ... For the VIP silencing experiments (Figure 7H) 3 VIP-Cre mice were injected with a mixture of viruses expressing GcaMP7f (pGP-AAV9-syn-jGCaMP7f-WPRE, Addgene) and Cre-dependent ArchT (pAAV-FLEX-ArchT-tdTomato (AAV5) ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting a DNA sequence within the first exon of the FasL gene (5’-CTGGGCACAGAGGTTGGACA-3’) was cloned into the BsmBI restriction site of the 3rd generation LentiCRISPR.V2 (Addgene, #52961) vector ...
-
bioRxiv - Neuroscience 2024Quote: ... -2.2 mm ventral from skull under an angle of 10°) and injected with AAV5-hSyn-DIO-mCherry (3*10^12 gc/ml; 300nl; Addgene) in LHA (-1.3 mm posterior to bregma ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Biochemistry 2024Quote: ... roseus were assembled using the GoldenBraid 2.0 kit (Sarrion-Perdigones et al., 2013) (Addgene kit # 11000000076) (Fig ...
-
bioRxiv - Plant Biology 2020Quote: ... from Sylvestre Marillonnet (Addgene kit # 1000000044). Specific parts (target gRNA or siRNA sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: The MoClo Toolkit (Addgene Kit #1000000044), MoClo Plant Parts Kit (Addgene Kit #1000000047) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GreenGate Cloning System (Addgene Kit #1000000036) and amilCP_Orange chromoprotein vector (Addgene Plasmid #117850 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... including existing parts (Addgene Kit # 1000000080) and custom-made parts (Table 2) ...
-
bioRxiv - Neuroscience 2019Quote: Mouse Rit2 (mRit2) cloned into pGEX2T was a gift from Julian Downward (Addgene plasmid #55663)[59] ...
-
bioRxiv - Cancer Biology 2019Quote: SgRNAs targeting mouse Wnt5a or Yap1 were cloned into pSpCas9(BB)-2A-Puro (Addgene, #62988) and transfected into target cells ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid for inserting transgene into mouse genome: pBT378_pattB-pCA-GFP-pA-attB plasmid (Addgene, 52554).
-
bioRxiv - Cancer Biology 2023Quote: ... GSDME-EGFP or mouse Mlh1 lentiviral vector and packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: The majority of the constructs used for expressing aggregating proteins were obtained from Addgene (Watertown, MA). The Addgene catalog numbers are as follows ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Biophysics 2019Quote: ... both proteins were expressed in HEK293T cells using a modified pTT5 expression vector (Addgene no. 44006), purified using StrepTactin beads (GE ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA encoding EGFP-LC3 fusion protein was released from pBABE-EGFP-LC3-puro (Addgene, #22405) and cloned into pQCXIN-EGFP-N1-Neo by the 5’-EcoRI and 3’-AgeI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Systems Biology 2023Quote: Jurkat cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... All clones for lentiviral vectors expressing the proteins described in this study are available from Addgene.