Labshake search
Citations for Addgene :
1751 - 1800 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Cells stably expressing shRNA of different genes under the control of a tetracycline-inducible promoter were created by first transducing SNB-19 cells with lentivirus particles containing pLenti CMV TetR BLAST (Addgene; number 17492). The cells underwent selection with media containing 10 μg/mL of blasticidin (Invivogen ...
-
bioRxiv - Genetics 2020Quote: A single vector AAV-Cas9 system containing SaCas9 and its sgRNA scaffold with a CMV promotor was purchased from Addgene (Catalog #61591).27 Three sequences of SaCas9 were replaced with E782K ...
-
bioRxiv - Developmental Biology 2021Quote: The p133-pPB plasmids encoding for the Tal1-gRNAs were co-transfected with the pX458 plasmid containing a Cas9 nuclease construct and a GFP reporter (pSpCas9-2A-GFP, Addgene ID: 48138), kindly provided by Jamie Hackett from EMBL Rome ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3.1-HA-UBA6, containing the coding sequence for UBA6 (aa1-1052, Uniprot: A0AVT1) was a gift from Marcus Groettrup (Addgene plasmid #136995). UBA6 was subcloned into pDARMO with an N-terminal FLAG-tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... HeLa cells were generated by infecting cells with lentivirus containing a Cas9-P2A-GFP expression cassette under a doxycycline inducible promoter as described previously (Addgene plasmid #85400)50 ...
-
bioRxiv - Neuroscience 2022Quote: The AAV overexpressing hEsyt1 was developed utilizing a pAAV-hSyn-DIO[hCAR]off-[hM4Di-mCherry]on-W3SL backbone construct containing the W3SL cassette (Addgene plasmid #111397). First ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli chromosome at the λ integration site by electroporating this plasmid into DH10B cells containing the helper plasmid pInt-ts (Addgene #66076) and selecting for kanamycin resistant colonies ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus containing all mentioned plasmids was generated by transfecting HEK293T cells with the appropriate plasmid along with the psPAX2 (Addgene; Plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Synthetic Biology 2023Quote: The genes gabT and gabP were deleted from the EcN genome using the pSIJ8 plasmid (Jensen et al. 2016) containing the lambda Red recombineering system and ampicillin resistance (Addgene plasmid #68122). The plasmid was transformed into EcN via electroporation ...
-
bioRxiv - Cancer Biology 2023Quote: ... by cloning annealed oligonucleotides containing the targeting sequence (Table S4) into the pSpCas9(BB)-2A-Puro vector (a gift from Feng Zhang, Addgene plasmid # 48139) (Ran et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... which involved the co-transfection of the plasmid containing the CDC50A target sequences and the Cas9 gene with a donor plasmid (pDonor-tBFP-NLS-Neo; Addgene plasmid #80766) referred to as Donor ...
-
bioRxiv - Bioengineering 2023Quote: ... Two plasmids were chosen for further development: a plasmid containing both an empty sgRNA scaffold as well as GFP (AddGene plasmid# 99375) with a final goal of VLP generation ...
-
bioRxiv - Cell Biology 2023Quote: Vectors for this reporter assay were constructed using a lentiviral construct containing CMV-DsRed and UBC-EGFP on a pHAGE backbone purchased from Addgene (plasmid #24526). This lentiviral construct then underwent site directed mutagenesis using the Agilent QuikChange II kit ...
-
bioRxiv - Biochemistry 2023Quote: ... fluorophore labelled ‘601’ DNA was generated using large-scale PCR with Phusion polymerase (produced in-house) from a pGEM- 3z/601 plasmid containing one copy of ‘601’ DNA (gift from J. Widom, Addgene plasmid #26656)(Lowary & Widom ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10-fold serial dilution in H20 was prepared of a commercially available bacterial plasmid (pBR322) containing the JCPyV Mad-1 full sequence (girt from Peter Howley, Addgene plasmid # 25626) [46] ...
-
bioRxiv - Cell Biology 2023Quote: ... was synthesized and cloned into a vector containing homology arms targeting the AAVS1 safe harbor site (AAVS1 SA-2A-puro-pA donor vector (Addgene: Plasmid #22075)(60)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Templates for the in vitro transcription of sgRNAs were generated either by subcloning annealed oligonucleotides containing the target sequences into pDR274 (Addgene, plasmid #42250) via BsaI as described previously (gdf6Y-inactivation ...
-
bioRxiv - Cell Biology 2024Quote: ... The fragment encoding the Cerulean gene containing 3xNLS was amplified from the template pCerulean-PCNA-19-SV40NLS-4 (a gift from Michael Davidson; Addgene plasmid # 55437) using primer pair 6380 (5’- GGA GCC TCA GCC GCT TCA GCT GCT CCG GTC GCC ACC ATG GTG AG -3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... a fragment containing mTurquoise2 and the mSTING CDN was amplified by PCR and cloned in a pLex306 backbone (David Root, Addgene plasmid #41391). The sequence of E ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning (69) ...
-
bioRxiv - Microbiology 2021Quote: ... which was obtained from Addgene (Kit #1000000137). Initially the aph coding sequence in pAJM.011 was replaced by the bla coding sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... pENTR BRAF and pENTR BRAFV600E were gifts from Craig Ceol and pLenti CMV/TO Neo DEST (685-3) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17292). To generate pLenti CMV/TO NRASQ61R Neo we performed Gateway cloning to insert NRASQ61R from the donor vector pDONR223 NRASQ61R into the destination vector pLenti CMV/TO Neo Dest ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Cell Biology 2022Quote: ... sequence 5’-AGC GGC ATG AAG CAC TCA AT-3’ targeting the last coding exon of Fn1 was subcloned downstream the U6 promoter into the PX459 vector (Addgene, cat # 62988) encoding the Cas9-2A-Puromycin cassette (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2019Quote: Two plasmids that express the needed gRNAs were made by inserting oligonucleotides (files S11) into the pCFD3-cU6:gRNA plasmid where they would be expressed from the pU6-3 promoter (Addgene plasmid #45946).
-
bioRxiv - Neuroscience 2019Quote: ... These were cloned in parallel into the 3’UTR of the luciferase gene in the pIS-0 vector (12178, Addgene, Cambridge, MA) [27] and DNA extracted and purified ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’ – CCGTTATCCACTTCCAATCCCTCGCAGACAGCGAA TTAATTCCAGCA – 3’ and were designed for overlap with pET His6 TEV LIC cloning vector (1B) (a gift from Scott Gradia, Addgene plasmid #29653). The pET His6 TEV LIC cloning vector (1B ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Genomics 2019Quote: ... were seeded in a 12-well plate and cultured for 24 h before transfection with Sp1-luciferase reporter plasmid DNA (0.5 g; Panomics, Fremont, CA, USA) or a 3× ERE TATA luc construct (Addgene, Cambridge, MA, USA) for 24 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we infected H9c2s with shRNA against RORα or scrambled shRNA for 48hrs then transfected with an EGFP-Cav-3 plasmid (Addgene plasmid #68396) or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931 ...
-
bioRxiv - Cell Biology 2020Quote: ... targeting KIF4A sequence 5’-GCAAGATCCTGAAAGAGAT-3’ was generated using a multipurpose GATEWAY-based lentiviral tetracycline-regulated conditional RNAi system (GLTR) using pENTR-THT-III (Addgene plasmid #55791) and pGLTR-X-Puro (Addgene plasmid #58246 ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Genomics 2020Quote: ... the 3×Flag-BUD13-6HIS fragment was transferred into the pLJM1 lentiviral construct using the NdeI and EcoRI sites (Addgene plasmid # 19319). We produced lentiviruses via co-transfection of pCMV-d8.91 ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA) ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Neuroscience 2022Quote: miR-30a-chimeric hairpins for miR-329 and miR-495 stable overexpression were generated via polynucleotide cloning into the 3’ UTR of eGFP in pAAV-hSyn-EGFP vector (Addgene Plasmid #114213) using BsrGI and HindIII sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...