Labshake search
Citations for Addgene :
1601 - 1650 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... was achieved through the bilateral stereotaxic injection of an Adeno-Associated virus containing a cre-recombinase enzyme (AAVpmSyn1-EBFP-Cre, Addgene#51507) into the OB of Ghsrfl/fl∷Ai14 RFP (designated OBGHSR−/− ...
-
bioRxiv - Molecular Biology 2023Quote: Fragment of DNA containing the ORF of hSSB1 was cloned into plasmid 2BT (pET His6 LIC cloning vector, Addgene plasmid #29666) via ligation independent cloning (LIC) ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... with a PCR product containing a T2A-HygR cassette that was amplified using primers 3551/3552 and template lenti MS2-P65-HSF1_Hygro (Addgene Plasmid #61426). The initial control insert shRNA NT control #4 was replaced by digesting pZIP-ZsGreen-T2A-Hyg-shNT4 with NotI and MluI and inserting miR-30-based shRNAs for cFLIP (sh1 ...
-
bioRxiv - Neuroscience 2023Quote: ... the custom library transfection mix was prepared in the following manner: 15 µg of custom library plasmid and 15 µg of third-generation packaging DNA mix containing pRSV-REV (Addgene #12253), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Genomics 2023Quote: The A549-TetR-Cas9 cell line was created by simultaneously transfecting A549 cells with piggyBac transposase and a piggyBac cargo plasmid containing TetR-inducible Cas9 (Addgene #134247), and selecting for 7 days with 500 ug/mL G418 ...
-
bioRxiv - Bioengineering 2023Quote: ... We ordered pairs of complementary forward and reverse single stranded oligonucleotides (IDT) for each guide containing compatible overhang sites for insertion into a lentiCRISPRv2-Puro (Addgene #98290) backbone ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Neuroscience 2023Quote: ... the transgene p130PH or p130PHR134L were amplified using PCR from the pEGFP-N1 plasmids containing these genes31 and inserted into the Ef1α-DIO-mCherry viral vector (Addgene, #47636). AAVTM6 viruses were produced at Janelia Viral Tools facility ...
-
bioRxiv - Cell Biology 2023Quote: ... organoids were electroporated with CRISPR-concatamer vectors containing gene-specific guide RNAs (gRNAs) in combination with a Cas9 expression plasmid (Addgene #41815), at a 1:1 ratio ...
-
bioRxiv - Cancer Biology 2022Quote: ... NLS-catalase and TET-ON NLS-catalase plasmids were obtained from cloning the catalase and c-myc sequences into a hygromycin-containing backbone vector (Addgene, #17446). H3.1 C96S-Flag (blasticidin as selection mark ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase plasmid (blasticidin as selection mark) was obtained from cloning the luciferase sequence into a blasticidin-containing backbone vector (Addgene, #17445). HEK293 cells were transfected at 70 to 80% confluency using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: All the Cas9-expressing THP-1 cells or iPSC lines in this study were derived by lentiviral transduction with a Cas9 expression vector containing an optimized sgRNA backbone (LentiCRISPR v2; Addgene, 52961). All of the sgRNAs were cloned into the LentiCRISPR v2 vector following the protocol described before41 ...
-
bioRxiv - Immunology 2023Quote: ... expressing the firefly coding sequence under control of a synthetic promoter containing SMAD-binding elements (SBEs) was obtained from AddGene (#45126). pEFBOS mCherry-mSTING expressing monomeric Cherry fused to the N-terminus of murine STING ...
-
bioRxiv - Molecular Biology 2023Quote: ... each cell line was given fresh growth medium and transfected with a plasmid mixture containing 1μg PB-rtTA (Addgene #126034; 22) and 1μg pUC19-piggyBac transposase 23 using Lipofectamine 3000 (Thermo Fisher L3000001) ...
-
bioRxiv - Cell Biology 2023Quote: ... Reporter lines were then transduced with lentivirus containing osTIR1-9xMyc which was subcloned from pBabe Puro osTIR1-9xMyc from the laboratory of Andrew Holland (Addgene 80074) and selected with 7.5 μg/mL Zeocin (Invivogen ant-zn-05 ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: To generate a BAC vector containing UAS-GFP the following cassette 10X UAS-IVS-Syn21-GFP p10 UTR was excised from pJFRC81 (Addgene 36432) with HindIII and FseI and ligated into pIM145 ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Genomics 2023Quote: ... Lentivirus containing the landing pad sequence was produced by co-transfecting 293T cells at ∼50% confluence with psVSV-G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral vector pLenti-CMV-Puro-DEST containing EGFP-rNLRP1-MYC was transfected into Lenti-X cells together with packaging plasmid psPAX2 (Addgene #12260) and Lentiviral envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Labor-associated endogenous gene promoters were cloned into the pGL4.23 backbone either directly from gDNA (using overhang-containing primers) in the case of the Fos promoter (Addgene catalog #188113), or from transitional pJET-1.2 vector backbones containing the cloned promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... they were transduced with lentivirus containing pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep #17446-LV)] at a multiplicity of infection of 10 for 48 hours before washing with PBS and replacing with fresh medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cloned into a Cas9-T2A-Puromycin expressing plasmid containing the U6-gRNA scaffold (gift of A. Németh; Addgene plasmid, 101039). 8 μg of plasmid was used to transfect mESCs using the Promega FuGENE 6 transfection kit ...
-
bioRxiv - Genomics 2024Quote: ... a variant of which containing a ribosomal binding site and mRFP in place of a gene fragment has been deposited to Addgene (Addgene #209325). A slight modification to this plasmid was made to include SapI type II restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... The first plasmid encodes the inserted sequence flanked by two microhomology arms with a length of 40 bp and containing short PITCh sequences at their distal ends (modified based on pCRIS-PITChv2-FBL, Addgene #63672) (Sakuma et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Plcxd2fl/fl:Rorb-Cre and Plcxd2+/+:Rorb- Cre pups were injected with 50nL of a mixture containing AAV-TRE-DIO-FLPo (Addgene #118027) and AAV-TRE-fDIO-GFP-IRES-tTA (Addgene #118026 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used CRISPRi-i3 iPSCs containing a CAG promoter-driven dCas9-BFP-KRAB cassette inserted into the CLYBL safe harbor locus (Addgene #127968). iPSCs were transduced with control gRNA or a previously validated gRNA targeting DRP184 and differentiated as described above.
-
bioRxiv - Cancer Biology 2021Quote: Indicated cell lines were transfected using lipofectamine 3000 with 3 µg of p65 reporter plasmid (pHAGE NF-κB-TA-LUC-UBC-GFP-W plasmid from Addgene #49343). After 48h ...
-
bioRxiv - Cell Biology 2020Quote: ... A template vector which carries full-length AID-3 × FLAG-P2A-BSD was produced with the backbone of pMK392 (Addgene, 121193). Full-length AID-3×FLAG-P2A-BSD was integrated into the site just before the terminal codon of the sub-cloned CENP-E gene ...
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Genetics 2021Quote: ... hermaphrodites were injected with 0.25ng/μl mks-3::gfp and 100ng/μl coel::dsRed (gift from Piali Sengupta, Addgene plasmid #8938) to generate extrachromosomal arrays (1-7 lines each) ...
-
bioRxiv - Genetics 2020Quote: Flies expressing a gRNA targeting the rosy (ry) locus (5’-CATTGTGGCGGAGATCTCGA-3’) were generated by cloning the gRNA sequence into the pCFD3 plasmid (Addgene #49410) as in [44] ...
-
bioRxiv - Developmental Biology 2020Quote: The LV-MiniP-H2B-GFP vectors were prepared by inserting the respective MimiP sequences (24) into the LV-H2B-GFP vector (3) (Addgene, #25999) using PCR introduced SalI ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the generation of the double K73E K80E (2KE) sov mutant two guides (Supplementary Table 3) were cloned into pDCC6 (Addgene 59985) and co-injected with an AltR HDR donor oligo (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Genomics 2020Quote: ... The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table. The INTS6 PCR product and MSCVpuro vector (Addgene 68469) were digested with XhoI (NEB R0146 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’–CACCTTTGCCACTCTCAAAGGGGA-3’ and sgRNA REV: 5’-AAACTCCCCTTTGAGAGTGGCAAA-3’) was cloned into a BbsI digested pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (42230; Addgene, Cambridge MA). Template DNA for in vitro transcription was generated by PCR amplification of the gRNA sequence—which included both the guide sequence as well as the scaffold sequence encoded in the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid—using Phusion HF DNA polymerase and a primer set (synthesized by IDT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Cell Biology 2021Quote: ... The UAS sites and K10 3’UTR were replaced via PCR with the squash promoter and squash 3’UTR from pBS-Squ-mCherry (Eric Wieschaus56, Addgene 20163). The RhoGEF2 ORF was obtained from the DGRC (SD04476) ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Cell Biology 2021Quote: ... the rps-0 promoter and the unc-54 3’ UTR fragments were combined and inserted into the pMLS257 plasmid (Addgene #73716) using the SapTrap assembly method (Schwartz and Jorgensen ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression vectors for NFAT4 D-site variants were prepared by subcloning residues 3 – 407 of WT NFAT4 from the corresponding mammalian expression vector (Addgene #21664) into pGEX4T1 ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...