Labshake search
Citations for Addgene :
1351 - 1400 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Developmental Biology 2024Quote: ... we utilized monomeric enhanced green fluorescent protein (mEGFP) (gift from Karel Svoboda, Addgene plasmid #18696) (Harvey ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biochemistry 2024Quote: ... The tag-free wildtype (Wuhan-hu-1) nucleocapsid protein plasmid was purchased from Addgene (#177937), and the plasmid encoding the Strep-tagged nucleocapsid protein was a kind gift from Dr ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The dsRNA for Green fluorescent protein (GFP) was synthesised from plasmid pAC5.1B-EGFP (Addgene 21181) to be used as a negative control for off-target effects of dsRNA-mediated knockdown.
-
bioRxiv - Cell Biology 2020Quote: ... was produced in HEK293T cells that were co-transfected with the vector containing the gene of interest and second generation envelope and packaging plasmids (psPAX–gift from Didier Trono (Addgene plasmid#12260 ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Microbiology 2019Quote: ... Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928) and 0.31 μg pMD2.G plasmid ...
-
bioRxiv - Cell Biology 2022Quote: - AoSMC Flag/Flag-progerin: Retroviral particles containing pLPC-Flag and PLPC-Flag-progerin which were s a gift from Gerardo Ferbeyre (Addgene plasmid # 69059 ...
-
bioRxiv - Cell Biology 2022Quote: - AoSMC Inducible progerin-expressing cells: Lentiviral particles containing pLenti-CMV-TRE3GNeo-GFP progerin (gift from Tom Misteli (Addgene plasmid # 118710), pLentiCMV-TRE3G-GFP-laminA (gift from Tom Misteli (Addgene plasmid # 118709)) ...
-
bioRxiv - Cell Biology 2022Quote: ... a fragment containing the GIGYF2 sequence was obtained by PCR from the pcDNA4/TO/GFP-GIGYF2 vector (Addgene plasmid 141189) (34 ...
-
bioRxiv - Cell Biology 2022Quote: ... was generated by synthesizing (Genewiz) a sequence containing three copies of mCherry (based on the sequence from pHAGE-EFS-N22p-3XRFPnls; plasmid #75387; Addgene); the sequences encoding the mAID and SMASh degrons (from38) ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Neuroscience 2019Quote: A lentivirus that was developed for previous work in zebra finches (containing the vector pHAGE-RSV-GCaMP6f; Addgene plasmid #80315) was also used in canaries49 ...
-
bioRxiv - Molecular Biology 2019Quote: ... gRNAs were obtained by annealing and cloning complementary primers into vector pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) containing humanized S.pyogenes Cas9n(D10A) nickase (Addgene, cat. # 42335). Primers were designed to target the exon 2 of C6orf203 gene using E-CRISP double nickase platform (http://www.e-crisp.org/E-CRISP/ ...
-
bioRxiv - Biochemistry 2021Quote: ... the lentiCRISPRv2 plasmid containing the gRNA was combined with packaging vectors psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260) and pMD2.G (a gift from Didier Trono Addgene plasmid # 12259 ...
-
bioRxiv - Neuroscience 2020Quote: ... The constructs were subcloned using restriction digestion into the pHL-sec vector containing a C-terminal 6xHis-tag (Addgene # 99845). Restriction sites for subcloning were introduced by PCR at the 5’ and 3’ ends of scFv-Clasp heavy and light chains (light chain ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293T cells were transfected with the human PSD4 containing pLV lentivirus (VB160428-1095xdp – Vector Builder) together with the 3rd generation lentiviral packaging plasmid (Addgene): pMDLG/pRRE (Gag and Pol) ...
-
bioRxiv - Cell Biology 2021Quote: ... and the other containing the firefly luciferase gene under the control of the Pomc promoter (−646bp to +65bp) (#17553, Addgene). Forty-eight hours after transfection ...
-
bioRxiv - Synthetic Biology 2021Quote: ... S2060 bacteria were transformed with a luciferase reporter containing a quadruplet codon at residue 357 (for example, https://benchling.com/s/seq-7CsWcP8Ez4JNjNM9W23N, Addgene #134787) and an inducible qtRNA expression plasmid (for example ...
-
bioRxiv - Biochemistry 2021Quote: ... bacterial cells were co-transformed with the SDC-containing plasmid and pULTRA-CNF (Addgene # 48215, a gift from Peter Schultz) [14] ...
-
bioRxiv - Cell Biology 2021Quote: ... Oligos were ordered and BsmBI batch cloned into the gRNA expression cassette of a LentiCRISPR_v2 plasmid containing Cas9 (Addgene 52961). The library was amplified in Stbl3 (Thermo ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid pHAGE NFkB-TA-LUC-UBC-GFP-W containing the luciferase gene under the minimal NF-κB promoter was a gift from Darrell Kotton (Addgene plasmid #49343 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 cyclinB1-Venus/tubulin-mRFP cell line was generated in our lab by transduction with lentiviral vectors containing tubulin-mRFP (Addgene). RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene) ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... hDfs were transduced using lentiviral particles containing the pABpuro-BluF vector (pABpuro-BluF was a kind gift from Steven Brown (Addgene plasmid #46824 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Saturated cultures were centrifuged and resuspended in infiltration medium as described above except that cultures were diluted to 0.3 OD600nm and Agrobacterium strains were mixed in equal ratio with a strain containing pTRV1 (Addgene #148968). Seed of transgenic N ...
-
bioRxiv - Cell Biology 2022Quote: ... with plasmids containing Cas9 and the sgRNAs (the backbone used was plasmid PX459, a gift from Feng Zhang (Addgene #62988)) ...
-
bioRxiv - Neuroscience 2021Quote: ... We then inserted NFIA and SOX9 cDNA joined by a T2A sequence into an AAVS1 safe-harbor plasmid containing a dox-inducible cassette (Addgene plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragments were inserted using KpnI and MluI sites into the pCAG vector backbone containing a zinc-finger binding site upstream of a CAG promoter prepared from pCAG-GPHN.FingR-EGFP-CCR5TC (Addgene #46296)17.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was also infused into OFC in separate groups of animals as a null virus control ...
-
bioRxiv - Systems Biology 2019Quote: ... pCW-Cas9 Dox-inducible lentiviral vector and pLX-sgRNA lentiviral vector containing AAVS1-targeting sgRNA were all obtained from Addgene.
-
bioRxiv - Genetics 2020Quote: ... The plasmid containing 3XFLAG-dCas9/pTEF1p-tCYC1 was a gift from Hodaka Fujii and obtained via Addgene.org (Addgene plasmid #62190) (Fujita et al. ...
-
bioRxiv - Genetics 2019Quote: ... The plasmid containing 3XFLAG-dCas9/pTEF1p-tCYC1 was a gift from Hodaka Fujii and obtained via Addgene.org (Addgene plasmid #62190) [31].
-
bioRxiv - Systems Biology 2019Quote: ... the cells were transfected with a mix of 8 µg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library (Addgene #90294) (Hart et al ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells were co-transfected with pLX304 plasmids containing constructs of interest and the packaging plasmids pMD2.G (Addgene, #12259) and psPAX (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... The appropriate sgRNA oligonucleotides were individually annealed and cloned in a Cas9 or Cas9Nick containing vector: pSpCas9(BB)-2A-Puro (PX459) (plasmid#48139, Addgene) and pSpCas9n(BB)-2A-Puro (PX461 ...
-
bioRxiv - Cell Biology 2021Quote: ... preadipocytes isolated from BAT of Slc25a44ĩiox/ĩiox mice were immortalized by using the SV40 Large T antigen as described previously (Yoneshiro et al., 2019) and subsequently infected with a retrovirus containing either empty vector or Cre (#34565, Addgene), followed by hygromycin selection at a dose of 200 μg/ml.
-
bioRxiv - Neuroscience 2021Quote: Recombinant adeno-associated virus (AAV) vector containing a CCL2 expression cassette w as generated by replacing GFP cassette of pAAV-CAG-GFP (Addgene) with the full-length c DNA for CCL2 (OriGene) ...