Labshake search
Citations for Addgene :
1251 - 1300 of 2264 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Plant Biology 2024Quote: ... The MoClo Plant Parts Kit was a gift from Nicola Patron (Addgene kit # 1000000047) (Engler et al ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and cloned into a bicistronic expression vector (pX330) containing human codon-optimized Cas9 and RNA components (Addgene, #42230). The guide sequences targeting the AMPKα1 gene (PRKAA1 ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Synthetic Biology 2020Quote: ... donor vectors containing Tom20-CR driven by the CAG promoter were constructed using pAAVS1-P-CAG-mCh (Addgene, #80492). The pAAVS1-P-CAG-mCh vector was inversely amplified using primers that excluded the mCherry sequence flanked by the EcoRI site (termed pAAVS1-P-CAG-Tom20-CR) ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette tip of 20–30 μm containing CTB647 (ThermoFischer Scientific, C34778) or AAV (Addgene, AAV-PHP.eB) was lowered into the brain ...
-
bioRxiv - Neuroscience 2022Quote: ... We selected the TSC2Ex2-gRNA (TGTTGGGATTGGGAACATCGAGG) and cloned it into the Cas9-containing plasmid pSpCas9(BB)-2A-GFP (Addgene) as described (Ran et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... that contain DENDRA-expressing sequences optimized for use in C. elegans (Gallo et al. 2010) are annotated in Addgene as containing DENDRA2 (e.g., pEG545, Addgene plasmid #40116 and pEG345 ...
-
bioRxiv - Neuroscience 2021Quote: ... a glass pipette (0.1-0.2 mm diameter at the tip) containing the pAAV-Syn-Chronos-GFP (Addgene #59170-AAV1) or AAV1-hSyn-Cre (Addgene #105553-AAV1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Pathology 2020Quote: ... all inserts were sub-cloned to an expression vector containing hygromycin resistance (pLenti CMV Hygro DEST 117-1, Addgene) using the Gateway recombination system ...
-
bioRxiv - Genetics 2019Quote: ... Vector pZZ113 containing sgRNA expression cassette against cbr-dpy-5 was derived from PU6∷unc-119_sgRNA (Addgene plasmid # 46169) as described (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Adeno-associated virus containing the GCaMP7f gene (pGP-AAV9-syn-FLEX-jGCaMP7f-WPRE, 104488-AAV9, Addgene, Watertown, MA, USA) was loaded into a glass micropipette with a tip diameter of 40–50 µm attached to a Nanoject II injection system (Drummond Scientific ...
-
bioRxiv - Genetics 2021Quote: ... PT5/Cas9 cells were transfected with an equal-parts mixture of pLib6.4 containing an sgRNA library as well as pBS130 (26290, Addgene) using Effetene (301427 ...
-
bioRxiv - Microbiology 2021Quote: CRISPR plasmid constructs containing mosaic gRNAs were cloned by T4 ligase oligonucleotide insertion (Table S5) in px333 (Addgene #64073) or pLentiCRISPR-RFP657 (Addgene #75162 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the adherent cell cultures were cultured in the presence of lentiviral particles containing ΔLTR flanked CMV:tdTomato-blasticidin (Addgene#106173) and 8µg/mL polybrene (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSVG and pCMV-Delta 8.2 (Addgene). The lentiviruses were collected 48 hrs post transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 hrs ...
-
Somatostatin interneurons control the timing of developmental desynchronization in cortical networksbioRxiv - Neuroscience 2023Quote: Pups were injected at birth (P0) with a viral cocktail containing pAAV1-syn-GcaMP6s-WPRE-SV40 (Addgene, 100843-AAV1) and pAAV1-syn-GcaMP6s-Flex WPRE-SV40 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... GOI_gRNA2_F and GOI_gRNA2_R) containing gRNA sequence were annealed and cloned into BsaI site of the pU6-Universal vector (Addgene #52694). To generate a construct for deleting the entire coding region of GOI ...
-
bioRxiv - Genomics 2024Quote: ... were combined with CROPseq-Puro-F+E plasmid (containing the sgRNAs) or dCas9-mCherry-ZIM3-KRAB plasmid (Addgene 154473) and transfected using Lipofectamine™ 3000 (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: Pseudo-lentiviral particles containing sCD177 construct were generated using 293T cells and packaging vectors pMD2.G and pCMV-dR8.74psPAX2 (Addgene). Pseudo-lentiviral particles were transduced into the FreeStyle 293-F cells (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-eGFP, Addgene) was also infused bilaterally into either BLA (n=7) ...
-
bioRxiv - Cell Biology 2023Quote: ... which were co-transfected with the gRNA containing lentiCRISPRv2 vector together with the packaging vectors pMDLg/pRRE (Addgene; 12251), pRSV-Rev (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: PB-UniSAM containing mCherry was a gift from Lesley Forrester (Addgene plasmid # 99866; http://n2t.net/addgene:99866; RRID: Addgene_99866) (Fidanza et al ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid containing chTOG cDNA was a gift from Stephen Royle (Addgene plasmid # 69108; http://n2t.net/addgene:69108; RRID: Addgene_69108). The chTOG cDNA was subcloned into a modified pFastBac vector containing an N-terminal 6xHis tag (a gift from G ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ptch;p53 primary cell-line(#4954) was transduced using viral particles containing the lentiCas9-Blast vector (Addgene, Watertown, MA; RRID:Addgene_52962). Cells stably expressing Cas9 were selected using 10ug/ml Blasticidin S HCl (Gibco™-#R21001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Next day the transfection master mix which contained 10µg of CRISPR construct containing sgRNA targeting the gene of interest (or empty lentiCRISPRv1-puro, #49535, Addgene), 7.5µg of pSPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass pipette (tip diameter: ∼100 µm) containing the retrograde AAV-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene #51085) was slowly lowered into the IC at a rate of 1 µm/s using a micromanipulator (Sutter MP-285) ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... then transfected with Lipofectamine 3000 according to the manufacturer’s protocol with 2.5 µg of a plasmid containing Sleeping Beauty transposase (SB100X, AddGene #34879) and 2.5 µg of a plasmid containing either GFP or mCherry on a nuclear localization signal (NLS ...
-
bioRxiv - Biochemistry 2024Quote: ... A g-block gene fragment (IDT) containing the sequence for NCOA4383-522 was cloned into plasmid pDW363 (Addgene 8842) via HiFi assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... Gpr158fl/fl:Plcxd2+/+ and Gpr158fl/fl:Plcxd2fl/fl pups were injected with 50nL of a mixture containing AAV-TRE- Cre (Addgene #69136) and AAV-SYN-DIO-GFP-IRES-tTA (Addgene #85006 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...