Labshake search
Citations for Addgene :
1151 - 1200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Plasmids for microinjection were generated by amplifying the coding and flanking sequences from MT7 genomic DNA and introducing them with the PCR-based method CPEC (Quan & Tian, 2011) into the L4440 plasmid (Addgene, USA). DevPF1 was expressed with its endogenous flanking regions (304 bp upstream of the DevPF1 start codon and 272 bp downstream of the DevPF1 stop codon) ...
-
bioRxiv - Molecular Biology 2024Quote: Silencing constructs for DevPF2 and DevPF1 were generated by cloning genomic gene fragments into a T444T plasmid (Sturm et al., 2018) (Addgene, USA) using CPEC (Quan & Tian ...
-
bioRxiv - Molecular Biology 2024Quote: ... Weinberg (Addgene plasmid #8454), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... One million cells were transfected with the corresponding pools of guide RNAs and with the pX458 plasmid encoding for Cas9 and GFP proteins (48138, Addgene), using lipofectamine 2000 ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... and pEGFP (Addgene #165830). The antibodies used are as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... human H2BC1 and H2AZ2 cDNA were synthesized by Thermo Fisher and cloned into the pCW-Cas9 vector (Addgene #50661) by replacing the Cas9 gene ...
-
bioRxiv - Molecular Biology 2024Quote: We utilized the Gateway destination vector pMK-Cas9 (Addgene plasmid #113743) containing the Cas9 expression cassette and kanamycin resistance marker ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with the entry vector pENTR-PpU6sgRNA-L1L2 (Addgene plasmid #113735), which harboured the PpU6 promoter and sgRNA scaffold ...
-
bioRxiv - Molecular Biology 2024Quote: ... pYPQ132B (Addgene # 69282), pYPQ133B (Addgene # 69283 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pYPQ133B (Addgene # 69283) and pYPQ134B (Addgene # 179216 ...
-
bioRxiv - Immunology 2024Quote: ... LentiCRISPR v2 (a gift from Feng Zhang (Addgene plasmid # 52961) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... (for expression of HypaCas, Addgene #101178). Screening for knockout clones was performed via PCR and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pFA6a-NeonGreen-KanMX6 (Addgene plasmid 129099), and pSP1ctr5+-VN (Ioannoni et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... with pCL-Eco (Addgene 12371) and 8 µg/ml final concentration of polybrene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cargo RNA expression plasmids for mCherry-MS2×8 and Cre-MS2×8 were pFH2.22 (Addgene, #205537) and pJAM1.52 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA exporter EPN24-MCP-T2A-EGFP expression plasmid was pFH2.105 (Addgene, #205550). Cargo RNA expression plasmids for mCherry-MS2×8 and Cre-MS2×8 were pFH2.22 (Addgene ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Immunology 2024Quote: The human Calabrese CRISPR activation pooled library was a gift from David Root and John Doench (Addgene 92379, 92380). To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... that itself was a polycistronic derivative of Feng Zhang’s dual vector system (Addgene 61422, Addgene, 73797). Successive daughter plasmids were generated via simple ligation or Gibson assembly using annealed complementary oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing indicated recoveries of 99.997% (AUC = 0.62) and 99.986% (AUC = 0.64) of subcloned Calabrese half-library A (AUC = 0.59, Addgene) and B (AUC = 0.61 ...
-
bioRxiv - Immunology 2024Quote: ... and B (AUC = 0.61, Addgene) respectively (Fig S10i) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the four sgRNA cassettes were assembled into the attL5-attL2 vector pYPQ144 (Addgene # 69296) using Golden Gate assembly 58 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed dsDNA was sub-cloned into the BsmbI-digested lentiviral sgRNA-EFS-GFP/mCherry vector under the control of U6 promoter (LRG, Addgene #65656). To improve the transcription efficiency ...
-
bioRxiv - Molecular Biology 2024Quote: A pET28b plasmid encoding C-terminal 6xHis-tagged nuclear Pif1 (Addgene plasmid #65047)64 was employed to express and purify Pif1 from E ...
-
bioRxiv - Molecular Biology 2024Quote: ... We transfected 300,000 cells with 1.5 µg of flippase-encoding plasmid (Addgene #13787) and 0.5 µg of pLD037 using lipofectmamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pYPQ134B (Addgene # 179216) at the BsmBI site with Instant Sticky-end Ligase Master Mix (New England Biolabs®) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the four paired of oligos were ligated into pYPQ131B (Addgene # 69281), pYPQ132B (Addgene # 69282) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the pYPQ265E2 (Addgene # 164719) was used for generating attL1-attL5 Cas12a entry clones ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 μg packaging helper plasmid (psPAX2, Addgene #12260), 5 μg envelope helper plasmid (pMD2.G ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final plasmid was named p5E-UBI-loxTagBFP (Addgene #172518) and recorded in our database as 50_p5E-UBI-loxTagBFP.
-
bioRxiv - Molecular Biology 2024Quote: ... a custom R4-R2_destination clone named 1456-pDEST-minTol2_R4-R2_Cryst-eGFP (Addgene #171795 ...
-
bioRxiv - Molecular Biology 2024Quote: ... we gel extracted the 3x polyA sequence present on plasmid pENTR5’_ubi:loxP-EGFP-loxP (Addgene # 27322) and inserted it in the NotI-dephosphorylated p5E-UBI_Lflox_BFP plasmid through T4 ligation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was further digested using BamHI along with tol2kit 101_p5E-Ubiquitin plasmid (Addgene #27320). Both were purified and 101_p5E-Ubiquitin was dephosphorylated using NEB Antarctic phosphatase following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... was mixed with our 469-pME-iCre (Addgene #171792) and either with 101_p5E-Ubiquitin ...
-
bioRxiv - Molecular Biology 2024Quote: UBI:loxBFP:mKate:INTRON_miRsmn1-4141 was cloned using a Gateway LR-reaction mixing destination p5E-UBI-loxTagBFP (Addgene #172518) with our 010-pME-mKate2 ...
-
bioRxiv - Genomics 2024Quote: ... and transfected with 500 ng pMD-VSVg (Addgene #12259), 1,750 ng psPax2 (Addgene #12260) ...
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Genomics 2024Quote: ... 1,750 ng psPax2 (Addgene #12260), and 1,750 ng landing pad G384A vector template using 6 μL Fugene 6 (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and the top two scoring sgRNAs for each target gene based on depletion or enrichment phenotypes were cloned into dual sgRNA lentivirus expression vectors with direct capture tags (Addgene 187241)40 using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs #E2621L ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Developmental Biology 2024Quote: ... and FSW-HRP-V5-LRRTM2 (Alice Ting, Addgene, #82537) plasmids ...
-
bioRxiv - Developmental Biology 2024Quote: ... gifted by Peter Scheiffele (Addgene, #59409), and inserted into pcDNA3.1(+ ...
-
bioRxiv - Immunology 2024Quote: ... 1.5μg each) and a dCas9-VPR plasmid (pLenti-dCas9-VPR-blast, Addgene, #96917; 1μg) as described above ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid 73582).
-
bioRxiv - Genetics 2024Quote: The GFP control plasmid was obtained from Addgene, pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid 73582).
-
bioRxiv - Developmental Biology 2024Quote: ... cloned into pUC18 vector (Addgene plasmid #50004) with FRT sites added at both ends of the whole construct.
-
bioRxiv - Developmental Biology 2024Quote: ... cloned into pUC18 vector (Addgene plasmid #50004) with FRT sites added at both ends of the whole construct.
-
bioRxiv - Developmental Biology 2024Quote: ... The CDK1 FRET sensor was a gift from Jonathon Pines (Addgene plasmid # 26064). They were subcloned in the pCDNA 3.1 vector containing a T7 promoter and the constancy was confirmed via DNA sequencing ...