Labshake search
Citations for Addgene :
901 - 950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Neuroscience 2024Quote: ... MARK3-V5 (Addgene, 107235), shRNA control (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The oligo pool containing the sgRNA sequences was synthesized by Genewiz (Suzhou, Jiangsu, China) and cloned into lenti-guide-puro (#52963; Addgene, Watertown, MA, USA) as previously described51 ...
-
bioRxiv - Physiology 2024Quote: ... and pcDNA3-Flag-FKHR-ΔDB-AAA (Addgene 9022, 9023, 10694) were kind gifts from Dr ...
-
bioRxiv - Physiology 2024Quote: ... The EGFP-LC3B plasmid (Addgene 11546) was a kind gift from Dr ...
-
bioRxiv - Physiology 2024Quote: ... L4440 was a gift from Andrew Fire (Addgene plasmid#1654 ...
-
bioRxiv - Physiology 2024Quote: HEK 293T were transfected with a human TLR3 plasmid or an empty vector (Addgene). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Bioengineering 2024Quote: ... pCAG-Archon1-KGC-EGFP-ER2-WPRE (Addgene; #108423), using the methods above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... while sequences of Nlgn1 and LRRTM2 were amplified from pCAG-NL1(-) (Peter Scheiffele, Addgene, #15260) and FSW-HRP-V5-LRRTM2 (Alice Ting ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: pAAV-EF1a-W56-Linker-PSD95.FingR-eGFP-CCR5TC and pAAV-EF1a-Scr-Linker-PSD95.FingR-eGFP-CCR5TC were generated by replacing the BamHI/CsiI sites of pAAV-EF1a-PSD95.FingR-eGFP-CCR5TC (Addgene #125691) with the PCR products of the gene fragments (Twist Bioscience ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: pAAV_Ef1a-W56-Linker-mScarlet-Gephyrin.FingR-IL2RGTC and pAAV_Ef1a-Scr-Linker-mScarlet-Gephyrin.FingR-IL2RGTC were generated by replacing the NcoI/BstEII sites of pAAV-EF1A-mScarlet-Gephyrin.FingR-IL2RGTC (Addgene #125695) with the PCR products of the gene fragments (Twist Bioscience ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Physiology 2024Quote: ... pcDNA-mC/EBPb (#49198, Addgene, Watertown, MA, USA), pSV Sport PPAR gamma 1 (#8886 ...
-
bioRxiv - Physiology 2024Quote: ... and a pharyngeal fluorescence selection marker pCFJ90 (Addgene 19327) were injected into N2 young adults ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3′ extension oligos were cloned into pU6-tevopreq1-GG-acceptor (Addgene No.174038) by Golden Gate Assembly as previously described14 ...
-
bioRxiv - Bioengineering 2024Quote: ... inserts were PCR amplified from the epegRNA plasmids and from pCMV-PEmax (Addgene No. 174820) and inserted into the respective backbones (Addgene No ...
-
bioRxiv - Physiology 2024Quote: ... The GCaMP6S sequences were amplified from Addgene plasmid #40753 (59 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were transiently transfected with 1 μg of each plasmid expressing GCaMP6s (Addgene #277314.1040753) (Chen et al. ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a hNav1.5 plasmid (Addgene plasmid #145374; http://n2t.net/addgene:145374; RRID:Addgene_145374) was linearized with XbaI ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The CASE Gs protein construct is that designed and optimised by the Schulte lab (Schihada et al., 2021) and were obtained from Addgene. Mammalian mini-Gs constructs were a kind gift from Nevin Lambert (Wan et al. ...
-
bioRxiv - Physiology 2024Quote: ... L4440 was a gift from Andrew Fire (Addgene plasmid#1654; http://n2t.net/addgene:1654; RRID:Addgene_1654). The AedaeItp and AedaeItp-l targets were screened with a M13 forward (5’-TGTAAAACGACGCCAGT-3’ ...
-
bioRxiv - Physiology 2024Quote: ... Pparg1 or Pparg2 in NIH-3T3 cells was performed by transfecting pcDNA3.1(-) rat C/EBP alpha (#12550, Addgene, Watertown, MA, USA), pcDNA-mC/EBPb (#49198 ...
-
bioRxiv - Physiology 2024Quote: cDNA of the canonical NR4A3 transcript (NR4A3-203; NM_006981.4) was synthesised into a modified pLenti CMV Puro DEST (w118-1) vector (Addgene plasmid #17452) by GENEWIZ (Azenta Life Science ...
-
bioRxiv - Plant Biology 2024Quote: ... for C-terminal fusions we used pGADCg and pGBKCg (gift from Peter Uetz, Addgene plasmids #20161 ...
-
bioRxiv - Plant Biology 2024Quote: ... For N-terminal fusions with the GAL4-activation or -binding domains the vectors pGADT7-GW and pGBKT7-GW (gift from Yuhai Cui, Addgene plasmids #61702 ...
-
bioRxiv - Physiology 2024Quote: ... and cloned into Cas9/GFP expressing vector (pX458 from Addgene #48138). The sequence (CATAACTGGATATTCTGTAA ...
-
bioRxiv - Physiology 2024Quote: ... pLenti PGK Puro vectors expressing stable-HIF-11 (Plasmid #177202, addgene), pMD2.G (Plasmid #12259, addgene) and psPAX2 (Plasmid #12260, addgene) were ordered from Addgene.
-
bioRxiv - Physiology 2024Quote: UAS-Gαiact was generated from the Gαi cDNA clone (Addgene) LD22201 ...
-
bioRxiv - Plant Biology 2024Quote: ... and terminators) from the GB2.0 kit purchased from Addgene (https://www.addgene.org/kits/orzaez-goldenbraid2/) ...
-
bioRxiv - Neuroscience 2024Quote: ... Wickersham (Addgene plasmid no ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-dLight1.1 a gift from Lin Tian (titer 1.3 × 1012 genome copies per ml; Addgene viral prep # 111067-AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-dLight1.1 a gift from Lin Tian (titer 1.3 × 1012 genome copies per ml; Addgene viral prep # 111067-AAV1; http://n2t.net/addgene:111067; RRID:Addgene_111067) or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Neuroscience 2024Quote: ... and then 500 nL of AAV1-hSyn-GCaMP6s-WPRE-SV40 (Addgene: 100843-AAV1) was injected at a rate of 5 nL/second ...
-
bioRxiv - Neuroscience 2024Quote: ... the captured genomic regions were cloned into the hSTARR-seq_ORI vector (Addgene #99296; (79)) following linearization of the vector through restriction enzyme digestion using AgeI-HF (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-hM3D(Gq)-mCherry (Addgene, Catalog# v141469), pAAV5-hsyn-DIO-hM4D(GI)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-FLEX-tdTomato (Addgene, Catalog# 28306-PHP.S), pENN.AAV5.hSyn.TurboRFP.WPRE.RBG (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... a co-injection of AAV5- hsyn-FLEX-PSAM-GlyR-IRES-EGFP (AAV-FLEX-PSAM-GlyR-EGFP; Addgene, #119741) and AAV1-TRE-Cre (SignaGen Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats then received bilateral infusions of either AAV8-CAMKIIa-hM3D(Gq)-mCherry or AAV8-CaMKIIa-GFP (5×1012 vg/mL for both viruses; Addgene) into the VH (either A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV expressing Cre-dependent GCaMP6s (100842-AAV9, AAV9.CAG.Flex.GCaMP6s, Addgene) was injected unilaterally above the arcuate nucleus (ARC ...
-
bioRxiv - Neuroscience 2024Quote: ... The following three viruses were utilized: pAAV.1-CAG-GFP (#37825, Addgene), OE-Npbwr1-GFP ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 nl of AAV5-hSyn-DIO-hM4D(Gi)-mCherry virus (Addgene #44362-AAV5) was infused bilaterally at 100 nl/min ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, 44362, vg/mL) or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... gifts from Robert Campbell (Addgene plasmids #32444, #46021)(Wu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361, vg/mL) were injected in Nav1.8 Cre animals in in the NTS (from bregma ...