Labshake search
Citations for Addgene :
6651 - 6700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... pRSV-Rev and pMD2.G were acquired from Addgene (12251, 12253 and 12259, respectively). For purification of SYNJ2BP from E ...
-
bioRxiv - Neuroscience 2023Quote: ... pLV-TetO-hNGN2-eGFP-puro and FudeltaGW-rtTA were acquired from Addgene (55931 ...
-
bioRxiv - Neuroscience 2023Quote: ... The vectors used and their sources: AAV9-Ef1a-DIO-ChETA-EYFP (Addgene,); AAV5-hsyn-DIO-hM3D(Gq)-mCherry (Addgene,) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hsyn-DIO-hM3D(Gq)-mCherry (Addgene,); AAV9-syn-flex-GcaMP6s (Addgene,) ...
-
bioRxiv - Neuroscience 2023Quote: AAV1.Syn.FLEX.NES-jRGECO1a.WPRE.SV40(Addgene, 100853-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pMD2.G (Plasmid #12259) were obtained from Addgene. GFP-SynGAP was gifted by Yoichi Araki and Richard Huganir (Johns Hopkins University) ...
-
bioRxiv - Neuroscience 2023Quote: ... Prox1 (Addgene; 87129), Sp8 (Kawakami et al ...
-
bioRxiv - Neuroscience 2023Quote: ... The ISH probe sequences were obtained from the following sources: Nkx2.1 (Addgene; 15540), Lhx6 (Allen Brain Atlas ...
-
bioRxiv - Neuroscience 2023Quote: ... iPSCs were transduced with three lentiviruses – pTet-O-NGN2-puro (Addgene plasmid #52047 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Tet-O-FUW-EGFP (Addgene plasmid #30130 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Neuroscience 2023Quote: ... iPSCs were transduced with three lentiviruses – Tet-O-SOX9-puro (Addgene plasmid #117269), Tet-O-NFIB-hygro (Addgene plasmid #117271) ...
-
bioRxiv - Neuroscience 2023Quote: ... Tet-O-NFIB-hygro (Addgene plasmid #117271), and FUdeltaGW-rtTA (Addgene plasmid #19780) ...
-
bioRxiv - Neuroscience 2023Quote: ... and FUdeltaGW-rtTA (Addgene plasmid #19780). The cells were then replated at 200,000 cells/cm2 using StemFlex Medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and DsRed-rab9 DN (Addgene, Plasmid #12676), respectively ...
-
bioRxiv - Microbiology 2023Quote: HMGB1 plasmids for cell line construction were generated in a 2nd generation pLVX-M- puro transfer plasmid (Addgene plasmid# 125839). The HMGB1 sequence was obtained from the pcDNA3.1 Flag hHMGB1 plasmid (Addgene plasmid #31609).
-
bioRxiv - Cancer Biology 2023Quote: ... pLV-PLXNB2-dECTO (Addgene #86238), PLXNB2 OHu01778C_pcDNA3.1(+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLV-PLXNB2-dVTDL (Addgene 86239), pLV-PLXNB2-dECTO (Addgene #86238) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following overexpression vectors were used: pLV-PLXNB2-mRBD (Addgene #86240), pLV-PLXNB2-dVTDL (Addgene 86239) ...
-
bioRxiv - Bioengineering 2023Quote: ... was a gift from David Savage (Addgene plasmid # 79784 ...
-
bioRxiv - Bioengineering 2023Quote: ... was a gift from David Savage (Addgene plasmid # 79784; http://n2t.net/addgene:79784; RRID:Addgene_79784)12.
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... pDisplay-BirA-ER (a gift from Alice Ting (Addgene plasmid # 20856; http://n2t.net/addgene:20856 ; RRID:Addgene_20856)) was used as a PCR template for ER-BirA or PO-BirA ...
-
bioRxiv - Cell Biology 2023Quote: ... pDisplay-BirA-ER (a gift from Alice Ting (Addgene plasmid # 20856 ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... The pK19pA-MN plasmid was a gift from Steven Henikoff (Addgene plasmid #123461 ...
-
bioRxiv - Microbiology 2023Quote: ... Douglas Black (Addgene plasmid # 23026; http://n2t.net/addgene:23026; RRID: Addgene_23026) flanked by sequences overlapping the 3′ end of ca and the 5′ end of yfp ...
-
bioRxiv - Microbiology 2023Quote: The construct pFUS ΔIDR-YFP was created by PCR amplifying the fus gene from pGST- TEV-FUS (a kind gift from Dr. Aaron Gitler; Addgene plasmid # 29629 ...
-
bioRxiv - Microbiology 2023Quote: pLentiCRISPRv2 plasmid was purchased from Addgene (#52961) and gRNA inserted as described previously (95) ...
-
bioRxiv - Microbiology 2023Quote: ... psPAX2 (Addgene #12260), and pLp/VSVG (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: pCW57-MCS1-2A-MCS2 was purchased from Addgene (#71782) and used to conditionally express TTP and IFNλ1 derived from ZIKV infected hBMEC cDNA in the presence of doxycycline (0.2–1.0 µg/mL) ...
-
bioRxiv - Microbiology 2023Quote: ... DTRS406-S560 coding sequence (accession number WP_072564851.1) was then amplified from pET-22b DT 51E/148K (gifted by John Collier; Addgene plasmid # 11081 ...
-
bioRxiv - Microbiology 2023Quote: ... was then amplified from pET-22b DT 51E/148K (gifted by John Collier; Addgene plasmid # 11081; http://n2t.net/addgene:11081; RRID:Addgene_11081) and ligated into the SacI/XhoI restriction sites of pET28AIP56N1-E307 in frame with a C-terminal 6xHis-tag.
-
bioRxiv - Microbiology 2023Quote: ... Didier Trono (plasmid #12260, Addgene). The pVSV-G expression construct is described elsewhere (91) ...
-
bioRxiv - Microbiology 2023Quote: The construct pFUS ΔIDR-YFP was created by PCR amplifying the fus gene from pGST- TEV-FUS (a kind gift from Dr. Aaron Gitler; Addgene plasmid # 29629; http://n2t.net/addgene:29629; RRID: Addgene_29629) [120] with the addition of XhoI and BamHI sites using primers ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hSyn-hM4D(Gi)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50475; http://n2t.net/addgene:50475; RRID:Addgene_50475). We exposed the PM ...
-
bioRxiv - Cancer Biology 2023Quote: ... pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454). pCMV-dR8.2 dvpr was a gift from Bob Weinberg (Addgene plasmid # 8455).
-
bioRxiv - Cancer Biology 2023Quote: ... pCMV-dR8.2 dvpr was a gift from Bob Weinberg (Addgene plasmid # 8455).
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre mice were injected with AAV2/8.CAG.Flex.eGFP (Addgene, titer ≥ 1×10¹³ vg/mL) anterograde tracing virus in the HDB (antero-posterior ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2.9-CAG-Flex-GFP (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre animals injected with AAV2/5.EF1a.Dio.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: A set of PV-IRES-Cre animals injected with AAV2.9-CAG-Flex-ArchT-GFP (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol (54) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 15 μg of each of the viral envelope (pMD2.G; Addgene #12259) and viral packaging plasmids (psPAX2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... viral lenti-particles were generated by transfecting HEK293 cells in a T25 flask with 15 μg of the lentiviral WβS-reporter vector (7TGC; Addgene #24304 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pRSV-Rev was a gift from Didier Trono (Addgene plasmid # 12253 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was a gift from Daniel Haber (Addgene plasmid # 35637 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454 ...