-
No products found
because this supplier's products are not listed.
Stefanie Kühn, et al.,
bioRxiv - Biochemistry 2024
Quote:
... pcDNA5/FRT or pcDNA5/FRT/TO vectors (ThermoFisher Scientific) were used for protein expression in mammalian cells via transient transfection or for stable cell line generation ...
-
No products found
because this supplier's products are not listed.
Bas de Wolf, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... pcDNA5-FRT-TO-EGFP-AID (Addgene, 80075) was used as template for both the EGFP-AID and EGFP tags ...
-
No products found
because this supplier's products are not listed.
Michael Lewis, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
No products found
because this supplier's products are not listed.
Michael Lewis, et al.,
bioRxiv - Cell Biology 2022
Quote:
AD-293 cells were seeded and transfected the next day with either pcDNA5/FRT/TO-N-FLAG-hBirA*-GEMC1/MCIDAS or pcDNA5/FRT/TO-N-FLAG-hBirA* using PEI (Sigma-Aldrich) ±50 μM biotin (IBA GmbH ...
-
No products found
because this supplier's products are not listed.
Barbara B.R. Oliveira-Mendes, et al.,
bioRxiv - Physiology 2023
Quote:
... with 1.6 µg WT or mutant pcDNA5/FRT/TO Opti-hERG and 0.4 µg peGFP (Clontech, France) for fluorescence-based cell selection in microscopy24 ...
-
No products found
because this supplier's products are not listed.
Bertha Osei, et al.,
bioRxiv - Biochemistry 2024
Quote:
HELBKO HEK293T cells were transfected with plasmids encoding pcDNA5/FRT/TO-SFB-HELB variants or pcDNA5/FRT/TO-SFB-EV (empty vector) using PEI (Polysciences, Inc). After 24 hours ...
-
No products found
because this supplier's products are not listed.
Hannah L. Mackay, et al.,
bioRxiv - Cancer Biology 2024
Quote:
The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
No products found
because this supplier's products are not listed.
Sara Marie Ambjoern, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and a pcDNA5/FRT plasmid of interest using the Fugene 6 transfection kit (Promega) or Lipofectamine 2000 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Adrienne E. D. Stormo, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... a gift from Mark Cookson (Addgene plasmid #25361)77 was cloned into pcDNA5 frt/to by site-directed mutagenic removal of a single LRRK2 internal HpaI site (Quikchange, Stratagene), followed by HpaI/Eco53KI digest ...
-
No products found
because this supplier's products are not listed.
Wai-Lok Yau, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w) ratio using GeneJuice transfecting agent (Sigma-Merck) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Stable integrants of pcDNA5/FRT/TO plasmids were established by cotransfection with pOG44 by X-tremeGENE9 (Roche, 06365787001) and selected with blasticidin S (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Markus Höpfler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HEK T-REx wild type or SCAPER KO cells were seeded in 12-well plates and transfected the next day with pcDNA5/FRT/TO rescue plasmids and a puromycin-resistance conferring plasmid (MXS-CMV-PuroR) using TransIT-293 (Mirus). 24 hours after transfection ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... pcDNA5/FRT-SUGCT and pOG44 plasmid DNA was purified by NucleoBond Xtra Midi Plus EF DNA purification Kit (Macherey-Nagel). Purified pOG44 and pcDNA5/FRT-SUGCT plasmids were co-transfected into Flp-In 293 cells at a 9:1 ratio by using Lipofectamine 2000 reagent (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Monica Mesa-Perez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... to pcDNA5 integration vector and allowed to recover for 48h prior to selection with hygromycin (InvivoGen). Stable clones were pooled and tested for expression with the addition of 1ug/ml tetracycline (Sigma ...
-
No products found
because this supplier's products are not listed.
Hector L. Burgos, et al.,
bioRxiv - Microbiology 2020
Quote:
... The resulting 1,049 bp product containing LL-FRT-erm-FRT-spacer-random barcode-RL was purified by gel extraction using a QIAquick Gel Extraction Kit (Qiagen; 28706). The flanking 1 kb US and DS fragments for each targeted gene were then fused to this middle DNA fragment via the homology between the LL and RL sequences and using SOE-PCR with the F1 and R2 oligos ...
-
No products found
because this supplier's products are not listed.
Javier Cavieres-Lepe, et al.,
bioRxiv - Neuroscience 2023
Quote:
... lola-frt-stop-frt-luc larvae were raised in the dark on normal food supplemented with 15 mM luciferin (Carbosynth Ltd., Newbury, UK) until pupariation ...
-
No products found
because this supplier's products are not listed.
Sweyta Lohani, et al.,
bioRxiv - Neuroscience 2021
Quote:
Male and female C57BL/6J, ChAT-Cre (B6J.ChAT-IRES-Cre::frt-neo-frt, Jax stock no. 028861) and Ai162 (TIT2L-GCaMP6s-ICL-tTA2, Jax stock no. 031562) mice were kept on a 12h light/dark cycle ...
-
No products found
because this supplier's products are not listed.
Jothi K. Yuvaraj, et al.,
bioRxiv - Neuroscience 2020
Quote:
... but with the addition of the pcDNA5™/TO-specific selection antibiotic hygromycin (Gold Biotech). The resulting TREx/ItypOrco/ItypOR cell lines were analyzed for protein expression of myc-tagged Orco and V5-tagged ORs by Western blot ...
-
No products found
because this supplier's products are not listed.
Jungjoo Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... FRT deleted mice were bred with Tg(Thy1-CreERT2,-EYFP)HGfng/PyngJ mice (Jackson Laboratory). Thy1-CreERT2,-EYFP;Cdc50afl/fl mice were used for control and Cdc50a cKO mice ...
-
No products found
because this supplier's products are not listed.
Andrea Corno, et al.,
bioRxiv - Cell Biology 2022
Quote:
... pcDNA5-YFP-KNL119xMELT was generated by Gibson assembly also using a synthesized DNA fragment (Bio Basic Inc) to insert extra MELT motifs in the pcDNA5-YFP-KNL16xMELT plasmid between PmlI and BbvCI sites ...
-
No products found
because this supplier's products are not listed.
Kailene S. Simon, et al.,
bioRxiv - Biochemistry 2020
Quote:
Transfected Fischer rat thyroid (FRT) cells grown to confluence on 6-well “snapwell” transwell inserts (Corning) were mounted in Ussing Chambers (Physiologic Instruments) ...
-
No products found
because this supplier's products are not listed.
Jessica J. Simon, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Transfection mixes per 1×106 cells included 1.8 μg pCDNA5 TurboID/miniTurbo plasmid + 0.2 μg pMAX GFP to estimate transfection efficiency + 6 μL Turbofectin (Origene cat# TF81001)+ 100 μL DMEM ...
-
No products found
because this supplier's products are not listed.
Andrea Corno, et al.,
bioRxiv - Cell Biology 2022
Quote:
... cells were selected for stable integrants at the FRT locus using 200 µg/ml hygromycin B (Santa Cruz biotechnology) for at least 2 weeks ...
-
No products found
because this supplier's products are not listed.
Laurel A. Lawrence, et al.,
bioRxiv - Immunology 2024
Quote:
... FRT tissues were digested using collagenase type II (62.5 U/ml) and DNase I (0.083 U/ml) (STEMCELL Technologies). Cell suspensions were separated by Percoll (GE healthcare life sciences ...
-
Cat# MEVs-368,
1 vial, USD $1,338
No citation found on bioRxiv
-
Cat# ACMA00035940,
Inquire
No citation found on bioRxiv
-
Cat# HY-P70636-50 μg,
50 μg, USD $300.0
No citation found on bioRxiv